Incidental Mutation 'R7443:Olfr183'
ID577122
Institutional Source Beutler Lab
Gene Symbol Olfr183
Ensembl Gene ENSMUSG00000062105
Gene Nameolfactory receptor 183
SynonymsMOR183-2, GA_x54KRFPKG5P-55229158-55230087
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58995357-59001441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58999990 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 102 (F102I)
Ref Sequence ENSEMBL: ENSMUSP00000080602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073320] [ENSMUST00000206303] [ENSMUST00000213465] [ENSMUST00000214831] [ENSMUST00000214916]
Predicted Effect probably damaging
Transcript: ENSMUST00000073320
AA Change: F102I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080602
Gene: ENSMUSG00000062105
AA Change: F102I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-48 PFAM
Pfam:7tm_1 41 290 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206303
AA Change: F102I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000213465
AA Change: F102I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214831
AA Change: F102I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214916
AA Change: F102I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Olfr183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02294:Olfr183 APN 16 59000065 missense probably damaging 1.00
IGL02795:Olfr183 APN 16 59000277 missense possibly damaging 0.73
IGL02803:Olfr183 APN 16 58999958 missense probably benign 0.33
IGL02837:Olfr183 UTSW 16 59000546 missense probably damaging 1.00
R0045:Olfr183 UTSW 16 59000491 missense probably benign 0.00
R0372:Olfr183 UTSW 16 59000087 missense probably benign 0.03
R0652:Olfr183 UTSW 16 58999700 missense probably damaging 0.99
R0890:Olfr183 UTSW 16 58999787 missense possibly damaging 0.94
R1279:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R1429:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R1473:Olfr183 UTSW 16 58999912 missense probably benign 0.32
R2115:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R2117:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R4508:Olfr183 UTSW 16 58999775 missense probably benign 0.26
R4709:Olfr183 UTSW 16 59000095 missense probably benign 0.01
R4929:Olfr183 UTSW 16 59000219 missense probably damaging 1.00
R5478:Olfr183 UTSW 16 59000062 missense possibly damaging 0.88
R5522:Olfr183 UTSW 16 58999905 missense probably benign 0.22
R5571:Olfr183 UTSW 16 59000206 missense probably benign 0.02
R5685:Olfr183 UTSW 16 59000346 missense probably benign
R6064:Olfr183 UTSW 16 58999823 missense probably damaging 0.99
R7870:Olfr183 UTSW 16 58999723 missense probably benign 0.00
R7953:Olfr183 UTSW 16 58999723 missense probably benign 0.00
R8085:Olfr183 UTSW 16 59000069 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTACCACAGTGGAAACC -3'
(R):5'- TCATGAATCACAGCATGAAGAAAGC -3'

Sequencing Primer
(F):5'- TCATGACCATTGTCGGGAAC -3'
(R):5'- GCATGAAGAAAGCCACCTATAAATG -3'
Posted On2019-10-07