Incidental Mutation 'R7446:4930407I10Rik'
ID577320
Institutional Source Beutler Lab
Gene Symbol 4930407I10Rik
Ensembl Gene ENSMUSG00000075524
Gene NameRIKEN cDNA 4930407I10 gene
SynonymsLOC328573
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82059151-82066540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82066240 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1446 (D1446G)
Ref Sequence ENSEMBL: ENSMUSP00000097965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000100396] [ENSMUST00000229119]
Predicted Effect probably benign
Transcript: ENSMUST00000089178
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100396
AA Change: D1446G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524
AA Change: D1446G

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229119
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in 4930407I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:4930407I10Rik APN 15 82066380 missense probably benign 0.00
IGL02135:4930407I10Rik APN 15 82065004 missense possibly damaging 0.63
IGL02367:4930407I10Rik APN 15 82065547 missense probably benign 0.00
IGL02626:4930407I10Rik APN 15 82065609 missense probably damaging 0.99
IGL02885:4930407I10Rik APN 15 82063951 missense probably benign 0.36
IGL03199:4930407I10Rik APN 15 82062355 missense possibly damaging 0.65
R0062:4930407I10Rik UTSW 15 82063066 missense probably benign 0.00
R0062:4930407I10Rik UTSW 15 82066303 missense probably damaging 0.98
R0086:4930407I10Rik UTSW 15 82062601 missense probably benign 0.11
R0578:4930407I10Rik UTSW 15 82059355 missense possibly damaging 0.49
R1130:4930407I10Rik UTSW 15 82059360 missense probably benign
R1218:4930407I10Rik UTSW 15 82064152 missense probably benign 0.04
R1942:4930407I10Rik UTSW 15 82065424 missense probably damaging 0.98
R2380:4930407I10Rik UTSW 15 82064835 missense possibly damaging 0.92
R3945:4930407I10Rik UTSW 15 82065400 missense probably damaging 1.00
R4096:4930407I10Rik UTSW 15 82062205 missense probably benign 0.07
R4259:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4261:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4805:4930407I10Rik UTSW 15 82066427 nonsense probably null
R4992:4930407I10Rik UTSW 15 82064002 missense possibly damaging 0.60
R5094:4930407I10Rik UTSW 15 82062682 missense possibly damaging 0.72
R5161:4930407I10Rik UTSW 15 82063341 nonsense probably null
R5201:4930407I10Rik UTSW 15 82062544 missense probably benign 0.26
R5305:4930407I10Rik UTSW 15 82059219 missense possibly damaging 0.52
R5588:4930407I10Rik UTSW 15 82065216 missense possibly damaging 0.83
R5844:4930407I10Rik UTSW 15 82065864 missense probably benign 0.33
R6007:4930407I10Rik UTSW 15 82062739 missense probably benign 0.13
R6157:4930407I10Rik UTSW 15 82063416 missense possibly damaging 0.67
R6188:4930407I10Rik UTSW 15 82059270 missense probably benign 0.01
R6350:4930407I10Rik UTSW 15 82063563 missense possibly damaging 0.55
R6408:4930407I10Rik UTSW 15 82065106 missense possibly damaging 0.77
R6805:4930407I10Rik UTSW 15 82062543 missense possibly damaging 0.95
R6911:4930407I10Rik UTSW 15 82063867 missense probably benign 0.01
R6962:4930407I10Rik UTSW 15 82064949 missense probably benign 0.14
R7492:4930407I10Rik UTSW 15 82064359 missense possibly damaging 0.63
R7699:4930407I10Rik UTSW 15 82064105 missense probably benign 0.04
R7700:4930407I10Rik UTSW 15 82064105 missense probably benign 0.04
RF004:4930407I10Rik UTSW 15 82059349 missense possibly damaging 0.82
X0011:4930407I10Rik UTSW 15 82059285 missense probably damaging 1.00
X0026:4930407I10Rik UTSW 15 82063311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGCACATACATCCAGCTTG -3'
(R):5'- CTAAGGACTCTGAGCCTGTG -3'

Sequencing Primer
(F):5'- TACATCCAGCTTGAAAGGGAGTATCC -3'
(R):5'- GTGGCCTACTTTTTAAGGCCATACTG -3'
Posted On2019-10-07