Incidental Mutation 'R7446:Zfp277'
ID577313
Institutional Source Beutler Lab
Gene Symbol Zfp277
Ensembl Gene ENSMUSG00000055917
Gene Namezinc finger protein 277
Synonyms2410017E24Rik, NIRF4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location40315046-40445902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40328730 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 376 (R376H)
Ref Sequence ENSEMBL: ENSMUSP00000064226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069637] [ENSMUST00000069692]
Predicted Effect probably damaging
Transcript: ENSMUST00000069637
AA Change: R250H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068032
Gene: ENSMUSG00000055917
AA Change: R250H

DomainStartEndE-ValueType
ZnF_C2H2 59 84 4.27e1 SMART
coiled coil region 143 171 N/A INTRINSIC
ZnF_C2H2 174 198 3.85e1 SMART
ZnF_C2H2 225 249 2.24e-3 SMART
low complexity region 280 292 N/A INTRINSIC
ZnF_C2H2 303 326 1.91e1 SMART
ZnF_C2H2 356 382 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069692
AA Change: R376H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064226
Gene: ENSMUSG00000055917
AA Change: R376H

DomainStartEndE-ValueType
ZnF_C2H2 185 210 4.27e1 SMART
coiled coil region 269 297 N/A INTRINSIC
ZnF_C2H2 300 324 3.85e1 SMART
ZnF_C2H2 351 375 2.24e-3 SMART
low complexity region 406 418 N/A INTRINSIC
ZnF_C2H2 429 452 1.91e1 SMART
ZnF_C2H2 482 508 4.94e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early cellular preplicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Zfp277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Zfp277 APN 12 40378826 missense probably benign 0.24
IGL01477:Zfp277 APN 12 40320676 missense probably benign 0.00
IGL02081:Zfp277 APN 12 40328796 nonsense probably null
IGL02165:Zfp277 APN 12 40315803 missense possibly damaging 0.75
IGL02613:Zfp277 APN 12 40329515 missense probably damaging 1.00
IGL02688:Zfp277 APN 12 40328688 missense possibly damaging 0.95
IGL02825:Zfp277 APN 12 40317176 missense probably benign 0.06
R0194:Zfp277 UTSW 12 40378877 splice site probably benign
R0226:Zfp277 UTSW 12 40364162 missense possibly damaging 0.67
R0843:Zfp277 UTSW 12 40320600 critical splice donor site probably null
R1263:Zfp277 UTSW 12 40364165 missense probably damaging 0.99
R1584:Zfp277 UTSW 12 40378826 missense probably benign 0.12
R1609:Zfp277 UTSW 12 40328720 missense probably damaging 0.99
R1644:Zfp277 UTSW 12 40329610 splice site probably null
R1789:Zfp277 UTSW 12 40364085 missense probably benign 0.00
R1882:Zfp277 UTSW 12 40445746 missense probably benign 0.03
R2011:Zfp277 UTSW 12 40317218 nonsense probably null
R4884:Zfp277 UTSW 12 40363153 missense probably damaging 0.97
R4976:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5119:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5532:Zfp277 UTSW 12 40335309 missense probably damaging 1.00
R6340:Zfp277 UTSW 12 40318549 missense possibly damaging 0.57
R7191:Zfp277 UTSW 12 40329562 missense probably damaging 1.00
R7378:Zfp277 UTSW 12 40315853 missense possibly damaging 0.94
R7564:Zfp277 UTSW 12 40329595 missense probably damaging 0.99
R7861:Zfp277 UTSW 12 40315881 missense possibly damaging 0.92
R7944:Zfp277 UTSW 12 40315881 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCAGAAACATCTGGCAAGC -3'
(R):5'- CGAGAAACCGTTTTAACCTCG -3'

Sequencing Primer
(F):5'- GTAAACCACTGCTAACTACTTCTTG -3'
(R):5'- GAAACCGTTTTAACCTCGTTTATTG -3'
Posted On2019-10-07