Incidental Mutation 'R7477:Elmo1'
ID579574
Institutional Source Beutler Lab
Gene Symbol Elmo1
Ensembl Gene ENSMUSG00000041112
Gene Nameengulfment and cell motility 1
SynonymsC230095H21Rik, 6330578D22Rik, CED-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location20090596-20608353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20285319 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 26 (D26G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072519] [ENSMUST00000180626]
Predicted Effect probably benign
Transcript: ENSMUST00000072519
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180626
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Elmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
Debil UTSW 13 20373161 missense probably damaging 1.00
Dollie UTSW 13 20572446 missense possibly damaging 0.91
Edinburg UTSW 13 20290383 nonsense probably null
Golly UTSW 13 20373116 missense possibly damaging 0.96
sesame UTSW 13 20600212 nonsense probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1167:Elmo1 UTSW 13 20185455 missense probably damaging 1.00
R1511:Elmo1 UTSW 13 20290477 missense possibly damaging 0.60
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4990:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
R7338:Elmo1 UTSW 13 20280812 missense probably benign 0.37
R7378:Elmo1 UTSW 13 20280935 missense probably benign 0.00
R7593:Elmo1 UTSW 13 20290440 missense probably benign
R7721:Elmo1 UTSW 13 20280803 splice site probably null
R7778:Elmo1 UTSW 13 20589642 critical splice acceptor site probably null
R8001:Elmo1 UTSW 13 20286732 missense probably benign 0.05
RF008:Elmo1 UTSW 13 20274536 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTGGACATTACTACCACCTCAC -3'
(R):5'- AGGCGCTGAACTACCACTAC -3'

Sequencing Primer
(F):5'- TTACTACCACCTCACCATCCAGG -3'
(R):5'- TGAAAAGTAAATTTGCAGAAAGCTG -3'
Posted On2019-10-07