Incidental Mutation 'R1167:Elmo1'
ID 101179
Institutional Source Beutler Lab
Gene Symbol Elmo1
Ensembl Gene ENSMUSG00000041112
Gene Name engulfment and cell motility 1
Synonyms C230095H21Rik, 6330578D22Rik, CED-12
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 20090596-20608353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20185455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000152595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072519] [ENSMUST00000180626] [ENSMUST00000221067]
AlphaFold Q8BPU7
Predicted Effect probably damaging
Transcript: ENSMUST00000072519
AA Change: V10A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112
AA Change: V10A

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180626
AA Change: V10A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181429
Predicted Effect probably benign
Transcript: ENSMUST00000221067
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Elmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
braveheart UTSW 13 20274621 critical splice donor site probably benign
Debil UTSW 13 20373161 missense probably damaging 1.00
Dollie UTSW 13 20572446 missense possibly damaging 0.91
Edinburg UTSW 13 20290383 nonsense probably null
glasgow UTSW 13 20589642 critical splice acceptor site probably null
Golly UTSW 13 20373116 missense possibly damaging 0.96
Lockerbie UTSW 13 20600201 missense probably damaging 1.00
sesame UTSW 13 20600212 nonsense probably null
Tickle UTSW 13 20280803 splice site probably null
Wilmut UTSW 13 20582268 nonsense probably null
Writhe UTSW 13 20600259 critical splice donor site probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1511:Elmo1 UTSW 13 20290477 missense possibly damaging 0.60
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4990:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
R7338:Elmo1 UTSW 13 20280812 missense probably benign 0.37
R7378:Elmo1 UTSW 13 20280935 missense probably benign 0.00
R7477:Elmo1 UTSW 13 20285319 missense
R7593:Elmo1 UTSW 13 20290440 missense probably benign
R7721:Elmo1 UTSW 13 20280803 splice site probably null
R7778:Elmo1 UTSW 13 20589642 critical splice acceptor site probably null
R8001:Elmo1 UTSW 13 20286732 missense probably benign 0.05
R8133:Elmo1 UTSW 13 20373086 missense probably damaging 1.00
R8248:Elmo1 UTSW 13 20600201 missense probably damaging 1.00
R8685:Elmo1 UTSW 13 20290424 missense possibly damaging 0.61
R8713:Elmo1 UTSW 13 20274621 critical splice donor site probably benign
R8888:Elmo1 UTSW 13 20564460 missense probably damaging 1.00
R8895:Elmo1 UTSW 13 20564460 missense probably damaging 1.00
R8945:Elmo1 UTSW 13 20582268 nonsense probably null
R9292:Elmo1 UTSW 13 20600259 critical splice donor site probably null
R9389:Elmo1 UTSW 13 20185491 missense probably benign 0.01
R9417:Elmo1 UTSW 13 20572403 missense possibly damaging 0.57
R9472:Elmo1 UTSW 13 20286727 missense probably benign 0.31
R9622:Elmo1 UTSW 13 20208140 missense probably benign 0.01
R9661:Elmo1 UTSW 13 20285361 critical splice donor site probably null
RF008:Elmo1 UTSW 13 20274536 missense probably benign 0.32
Predicted Primers
Posted On 2014-01-15