Incidental Mutation 'R7561:Pik3r4'
ID585140
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7561 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105687247 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1347 (T1347A)
Ref Sequence ENSEMBL: ENSMUSP00000067400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000098441] [ENSMUST00000166431] [ENSMUST00000191268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065778
AA Change: T1347A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: T1347A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098441
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191268
AA Change: T1347A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: T1347A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,193,195 N314K probably benign Het
6030419C18Rik A G 9: 58,499,404 D199G probably damaging Het
A430005L14Rik T A 4: 153,960,640 I80N probably benign Het
Abca2 A G 2: 25,446,695 H2271R probably damaging Het
Acad8 T C 9: 26,979,242 I257V probably benign Het
Acot12 A T 13: 91,770,124 T179S probably damaging Het
Adcy10 A G 1: 165,559,172 R1155G possibly damaging Het
Adcy9 C T 16: 4,418,164 C461Y probably damaging Het
Adgrf1 G A 17: 43,311,109 V746I possibly damaging Het
Agbl1 C A 7: 76,698,761 Q869K unknown Het
AI837181 T G 19: 5,426,463 V218G probably damaging Het
Alg9 T C 9: 50,842,774 S585P possibly damaging Het
Arhgef38 T C 3: 133,160,728 Q216R Het
Asb4 A T 6: 5,430,968 H401L possibly damaging Het
Atg7 G T 6: 114,673,041 A60S possibly damaging Het
Atp10a T A 7: 58,827,133 C1199S probably damaging Het
Blm G A 7: 80,502,528 A557V probably damaging Het
Cbln1 A T 8: 87,471,996 M82K probably benign Het
Ccdc183 T G 2: 25,611,517 I293L probably benign Het
Col6a3 A G 1: 90,775,741 S3035P unknown Het
Cux2 A T 5: 121,879,868 S206T probably benign Het
Cyfip2 T C 11: 46,270,598 D355G probably benign Het
D430042O09Rik C T 7: 125,842,722 S627L probably benign Het
Dhrs2 A G 14: 55,237,241 H111R probably benign Het
Eif3b T G 5: 140,442,354 D781E probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fermt1 A T 2: 132,916,088 I469N probably benign Het
Fgf20 G T 8: 40,279,934 N154K possibly damaging Het
Fndc10 T A 4: 155,694,871 V124E probably damaging Het
Fra10ac1 T C 19: 38,221,876 D13G probably damaging Het
Gpatch1 A G 7: 35,309,375 S74P probably damaging Het
Gramd1b G A 9: 40,401,615 T19I unknown Het
Grm8 T C 6: 27,429,525 T457A probably benign Het
Gucy2g C A 19: 55,206,340 V882L probably benign Het
Hectd4 G A 5: 121,291,225 R811H possibly damaging Het
Hk1 C T 10: 62,281,028 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il10ra T A 9: 45,255,819 D480V probably benign Het
Il18rap A T 1: 40,524,377 H22L probably benign Het
Inpp5a T A 7: 139,567,422 I321N probably damaging Het
Kat2b T G 17: 53,641,258 L352R probably benign Het
Kcna1 A T 6: 126,642,145 V404E probably damaging Het
Mcm3ap T A 10: 76,492,878 V1110E possibly damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Mpdz A T 4: 81,307,151 N1368K probably damaging Het
Mpzl3 G T 9: 45,055,312 V24F probably benign Het
Mybph G A 1: 134,193,727 probably null Het
Ncam1 G T 9: 49,564,942 D282E probably damaging Het
Ntrk2 G A 13: 58,861,388 C331Y probably benign Het
Nwd2 T A 5: 63,807,091 C1339* probably null Het
Olfr1080 T C 2: 86,553,317 D269G probably benign Het
Olfr1450 T C 19: 12,954,039 V150A probably benign Het
Olfr411 T C 11: 74,347,610 probably benign Het
Osbpl6 C A 2: 76,586,154 T672N probably damaging Het
Pds5b T C 5: 150,739,318 probably null Het
Perm1 A G 4: 156,218,760 N587S probably benign Het
Pex7 A T 10: 19,894,266 C165* probably null Het
Pitpnm3 T C 11: 72,051,182 D933G probably benign Het
Rnf213 T A 11: 119,441,719 F2586I Het
Scn10a A G 9: 119,694,324 M1T probably null Het
Sdhaf3 T A 6: 6,956,079 L18Q not run Het
Sept7 A G 9: 25,297,855 E256G possibly damaging Het
Slc35b2 A G 17: 45,566,801 T236A probably damaging Het
Slc4a4 G A 5: 89,199,697 G766R probably damaging Het
Slco6c1 G T 1: 97,072,966 S537Y probably damaging Het
Srp68 T C 11: 116,248,767 E452G probably damaging Het
Taf2 A T 15: 55,055,833 M382K probably benign Het
Tas2r131 A G 6: 132,956,958 L296P probably benign Het
Tlr9 A G 9: 106,225,949 E813G probably benign Het
Trmt44 T C 5: 35,557,992 E659G possibly damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Unc45a G T 7: 80,331,586 S489R possibly damaging Het
Xrn1 T C 9: 95,999,458 V795A probably benign Het
Zbtb22 A T 17: 33,917,978 T366S probably benign Het
Zcchc10 T A 11: 53,324,718 H6Q probably benign Het
Zfp60 A G 7: 27,748,530 K208E probably damaging Het
Zfp780b A T 7: 27,964,612 C173S possibly damaging Het
Zfp786 C A 6: 47,819,733 R757L probably benign Het
Zfp936 G A 7: 43,189,915 A269T probably damaging Het
Zfp976 T C 7: 42,616,277 Y29C probably damaging Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7954:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGGCGCAGGTTTAACC -3'
(R):5'- TGCACATGAAGAAAGTCACCATG -3'

Sequencing Primer
(F):5'- AACCTCAGGCCTTTGTTTTTGAC -3'
(R):5'- TGAAGAAAGTCACCATGCCTAC -3'
Posted On2019-10-17