Mutagenetix > Incidental Mutation

Incidental Mutation 'R2165:Pik3r4'

235433

Institutional Source

Beutler Lab

Gene Symbol

Pik3r4

Ensembl Gene

ENSMUSG00000032571

Gene Name

phosphoinositide-3-kinase regulatory subunit 4

Synonyms

D9Ertd418e, 2210010O15Rik, C730038E05Rik

MMRRC Submission

040168-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2165 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

105642978-105687657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105672785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1025 (M1025K)

Ref Sequence

ENSEMBL: ENSMUSP00000139427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000191268]

AlphaFold

Q8VD65

Predicted Effect

probably benign
Transcript: ENSMUST00000065778
AA Change: M1025K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: M1025K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	1.7e-5	PFAM
Pfam:Pkinase	26	312	1.2e-18	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122710

Predicted Effect

probably benign
Transcript: ENSMUST00000186943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187573

Predicted Effect

probably benign
Transcript: ENSMUST00000191268
AA Change: M1025K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: M1025K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	8.9e-7	PFAM
Pfam:Pkinase	26	312	3.7e-23	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Meta Mutation Damage Score

0.1114

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,112,399	T806A	possibly damaging	Het
Adgre1	T	G	17: 57,419,338	L403R	probably damaging	Het
AF067061	A	T	13: 120,264,097	Q99L	probably damaging	Het
Alox12	A	T	11: 70,242,572		probably null	Het
Ankib1	A	T	5: 3,713,210	D506E	possibly damaging	Het
Ascc3	T	G	10: 50,721,839	Y1268D	probably damaging	Het
Bik	A	G	15: 83,541,423	M42V	probably benign	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Bub1	T	C	2: 127,801,281	I1048V	probably benign	Het
Cad	A	G	5: 31,062,220	N621S	probably damaging	Het
Camkv	C	A	9: 107,945,600	N69K	possibly damaging	Het
Ccdc110	T	C	8: 45,942,839	M589T	probably benign	Het
Ccdc154	T	A	17: 25,170,890	V498E	probably damaging	Het
Ccr1l1	A	G	9: 123,977,654	L252P	probably damaging	Het
Cdh1	T	C	8: 106,664,321	C690R	probably damaging	Het
Cfap157	T	G	2: 32,778,163		probably null	Het
Cux2	A	G	5: 121,887,477	S43P	possibly damaging	Het
Cyb5rl	C	T	4: 107,068,683	P21S	probably damaging	Het
Cyp51	T	G	5: 4,086,594	Q400P	probably damaging	Het
Dnah7b	T	C	1: 46,097,992		probably benign	Het
Ephb4	A	G	5: 137,354,426	I90M	probably benign	Het
Fam13c	A	G	10: 70,542,693	N269S	probably damaging	Het
Fam83c	T	A	2: 155,831,524	Y248F	possibly damaging	Het
Fat2	A	G	11: 55,303,716	F1166L	probably benign	Het
Fem1a	A	G	17: 56,257,686	N260D	probably benign	Het
Fnbp4	T	A	2: 90,767,399		probably null	Het
Fut9	T	A	4: 25,619,733	*360Y	probably null	Het
Fut9	T	A	4: 25,619,734	*360L	probably null	Het
Gm11639	G	A	11: 104,751,862	V1104I	possibly damaging	Het
Gm3727	T	A	14: 7,264,625	Q10L	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Haspin	A	C	11: 73,136,630	N544K	probably damaging	Het
Havcr1	A	G	11: 46,778,552	N286S	probably benign	Het
Lrp6	A	C	6: 134,459,283	C1307G	probably damaging	Het
Lrrc2	A	C	9: 110,979,577	H294P	possibly damaging	Het
Mon2	A	C	10: 123,042,364		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgprb1	T	C	7: 48,447,322	I281V	probably benign	Het
Muc4	A	G	16: 32,750,476	E118G	probably damaging	Het
Nefh	T	C	11: 4,943,872	D394G	probably damaging	Het
Neurl4	A	G	11: 69,903,221	T168A	probably benign	Het
Olfr347	T	A	2: 36,734,701	C127S	probably damaging	Het
Olfr642	T	C	7: 104,049,638	T239A	probably benign	Het
Olfr982	A	G	9: 40,074,915	N207D	possibly damaging	Het
Olfr987	A	T	2: 85,331,102	N265K	probably benign	Het
Oxsr1	A	C	9: 119,294,432	M92R	probably damaging	Het
Pde8a	T	C	7: 81,295,768		probably null	Het
Pex5l	T	A	3: 32,953,132		probably null	Het
Plch1	C	T	3: 63,698,482	E1325K	probably benign	Het
Plin2	A	T	4: 86,668,432	V54E	probably damaging	Het
Pqlc3	G	A	12: 16,989,839	L192F	probably damaging	Het
Prss47	A	T	13: 65,045,073	I298N	probably damaging	Het
Prune2	A	G	19: 17,120,182	R1017G	probably benign	Het
Psg19	T	A	7: 18,796,986	Y81F	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rrnad1	A	T	3: 87,927,053		probably null	Het
Serpinb1a	T	C	13: 32,850,414		probably benign	Het
Sh3pxd2a	A	T	19: 47,278,355	V265E	probably damaging	Het
Slc22a17	A	T	14: 54,908,825	Y337*	probably null	Het
Slc25a27	A	G	17: 43,657,772	V138A	probably benign	Het
Slc4a2	A	G	5: 24,431,316	Y220C	probably damaging	Het
Stab1	A	T	14: 31,168,435	S20T	probably benign	Het
Thsd1	G	T	8: 22,238,522		probably benign	Het
Tmem204	G	A	17: 25,080,592		probably benign	Het
Tom1l1	A	G	11: 90,649,895		probably benign	Het
Toporsl	T	A	4: 52,612,072	F655Y	possibly damaging	Het
Vmn2r98	A	G	17: 19,081,291	K852E	unknown	Het
Wdpcp	T	G	11: 21,691,884	L174R	probably damaging	Het
Zbbx	G	A	3: 75,112,107	P99S	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp600	A	T	4: 146,196,918	R719*	probably null	Het
Zfp697	C	A	3: 98,428,014	A365E	unknown	Het
Zfp957	A	C	14: 79,213,613	S249A	probably benign	Het

Other mutations in Pik3r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Pik3r4	APN	9	105644604	missense	possibly damaging	0.75
IGL01617:Pik3r4	APN	9	105654965	missense	probably benign	0.33
IGL01764:Pik3r4	APN	9	105685122	splice site	probably benign
IGL01817:Pik3r4	APN	9	105650822	missense	probably damaging	1.00
IGL01830:Pik3r4	APN	9	105644955	missense	probably damaging	1.00
IGL01905:Pik3r4	APN	9	105644878	nonsense	probably null
IGL01947:Pik3r4	APN	9	105686150	missense	possibly damaging	0.91
IGL01985:Pik3r4	APN	9	105663045	missense	probably benign	0.03
IGL02321:Pik3r4	APN	9	105644478	missense	probably benign	0.04
IGL02389:Pik3r4	APN	9	105650331	missense	possibly damaging	0.88
IGL02898:Pik3r4	APN	9	105650406	missense	probably benign	0.21
IGL03037:Pik3r4	APN	9	105650813	missense	probably damaging	1.00
boteh	UTSW	9	105667938	splice site	probably null
truth	UTSW	9	105650606	missense	probably damaging	0.98
verisimilitude	UTSW	9	105678153	missense	probably benign	0.17
IGL02835:Pik3r4	UTSW	9	105672706	missense	probably benign	0.07
R0011:Pik3r4	UTSW	9	105644637	missense	probably benign	0.01
R0312:Pik3r4	UTSW	9	105686210	missense	probably damaging	1.00
R0321:Pik3r4	UTSW	9	105648707	missense	probably damaging	1.00
R0482:Pik3r4	UTSW	9	105669045	missense	probably benign	0.04
R0645:Pik3r4	UTSW	9	105669187	splice site	probably benign
R0690:Pik3r4	UTSW	9	105653976	missense	possibly damaging	0.81
R0789:Pik3r4	UTSW	9	105685167	missense	probably benign	0.14
R0894:Pik3r4	UTSW	9	105667771	missense	possibly damaging	0.73
R0988:Pik3r4	UTSW	9	105687205	missense	probably damaging	0.97
R1123:Pik3r4	UTSW	9	105663129	missense	probably benign
R1172:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1174:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1342:Pik3r4	UTSW	9	105650901	critical splice donor site	probably null
R1387:Pik3r4	UTSW	9	105644291	missense	probably damaging	1.00
R1480:Pik3r4	UTSW	9	105687244	missense	probably benign	0.39
R1638:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R1643:Pik3r4	UTSW	9	105687152	missense	possibly damaging	0.83
R1995:Pik3r4	UTSW	9	105669165	missense	probably benign	0.12
R2037:Pik3r4	UTSW	9	105650335	missense	probably benign	0.00
R4210:Pik3r4	UTSW	9	105650758	missense	possibly damaging	0.57
R4515:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4519:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4630:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4632:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4732:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4733:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4940:Pik3r4	UTSW	9	105668994	missense	probably benign	0.20
R5120:Pik3r4	UTSW	9	105669009	missense	probably benign	0.30
R5169:Pik3r4	UTSW	9	105678161	missense	probably benign	0.14
R5183:Pik3r4	UTSW	9	105682308	missense	possibly damaging	0.87
R5353:Pik3r4	UTSW	9	105667938	splice site	probably null
R5463:Pik3r4	UTSW	9	105648731	missense	probably damaging	1.00
R5635:Pik3r4	UTSW	9	105667825	missense	probably benign	0.01
R5763:Pik3r4	UTSW	9	105669775	missense	probably benign	0.01
R5830:Pik3r4	UTSW	9	105644824	nonsense	probably null
R6251:Pik3r4	UTSW	9	105654048	missense	probably benign
R6468:Pik3r4	UTSW	9	105685190	missense	possibly damaging	0.86
R6611:Pik3r4	UTSW	9	105644277	missense	probably damaging	0.99
R6642:Pik3r4	UTSW	9	105644646	missense	probably benign	0.11
R6821:Pik3r4	UTSW	9	105650606	missense	probably damaging	0.98
R7039:Pik3r4	UTSW	9	105676890	missense	possibly damaging	0.76
R7144:Pik3r4	UTSW	9	105650584	missense	probably damaging	0.98
R7410:Pik3r4	UTSW	9	105650591	missense	probably damaging	0.99
R7559:Pik3r4	UTSW	9	105678153	missense	probably benign	0.17
R7561:Pik3r4	UTSW	9	105687247	missense	possibly damaging	0.94
R7658:Pik3r4	UTSW	9	105644511	missense	probably damaging	0.98
R7727:Pik3r4	UTSW	9	105669882	missense	probably damaging	0.99
R7871:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00
R7957:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R8138:Pik3r4	UTSW	9	105669035	missense	possibly damaging	0.55
R8686:Pik3r4	UTSW	9	105658529	missense	possibly damaging	0.50
R8719:Pik3r4	UTSW	9	105682195	missense	probably benign	0.00
R9091:Pik3r4	UTSW	9	105669909	missense	probably benign	0.35
R9189:Pik3r4	UTSW	9	105669839	missense	probably benign	0.22
R9270:Pik3r4	UTSW	9	105669909	missense	probably benign	0.35
R9439:Pik3r4	UTSW	9	105650842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCACAGTTTAAGATCCTTTTG -3'
(R):5'- GTCTTATAGACACTCCAGCCCC -3'

Sequencing Primer
(F):5'- AAGATCCTTTTGCTTTTTCTCAGGG -3'
(R):5'- CTGCCATCTAACAGGATTGTTTC -3'

Posted On

2014-10-01