Incidental Mutation 'R7573:Cfap157'
ID586127
Institutional Source Beutler Lab
Gene Symbol Cfap157
Ensembl Gene ENSMUSG00000038987
Gene Namecilia and flagella associated protein 157
Synonyms1700019L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7573 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32777381-32784428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32777508 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 521 (H521R)
Ref Sequence ENSEMBL: ENSMUSP00000099877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066352] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000102813] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000161958]
Predicted Effect probably benign
Transcript: ENSMUST00000066352
SMART Domains Protein: ENSMUSP00000068850
Gene: ENSMUSG00000053746

DomainStartEndE-ValueType
Pfam:Pept_tRNA_hydro 22 200 6.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102813
AA Change: H521R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987
AA Change: H521R

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably benign
Transcript: ENSMUST00000161089
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161958
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Homozygous knockout males are infertile owing to reduced sperm count and reduced and abnormal sperm motility as a result of abnormal sperm morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,573,268 I49F Het
1810055G02Rik T A 19: 3,715,728 M1K probably null Het
A430078G23Rik A G 8: 3,384,918 R188G probably damaging Het
Abcb1b G A 5: 8,828,866 C750Y possibly damaging Het
Abi2 T A 1: 60,470,708 V412D probably benign Het
Alk C T 17: 71,900,792 V983M probably damaging Het
Alppl2 A T 1: 87,088,231 W266R possibly damaging Het
Atp2c2 A T 8: 119,751,269 D695V probably damaging Het
B3gnt4 A T 5: 123,510,655 I28L probably benign Het
C2cd3 A G 7: 100,419,707 D536G Het
Cacna1c A G 6: 118,604,445 S1733P Het
Cacna1e T C 1: 154,726,165 probably benign Het
Capns1 A G 7: 30,192,535 F101L probably damaging Het
Ccdc180 A G 4: 45,922,015 T1030A probably benign Het
Cdh23 T C 10: 60,323,550 T2151A probably benign Het
Cenpe T A 3: 135,247,459 L1558Q probably damaging Het
Crygs T A 16: 22,805,319 *179C probably null Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cul9 T C 17: 46,519,910 T1686A probably benign Het
Cutc T C 19: 43,759,943 V95A probably benign Het
Cxcl3 A G 5: 90,786,246 T26A probably benign Het
Dnah9 A G 11: 66,125,215 V400A probably benign Het
Dysf A T 6: 84,130,122 N1139I possibly damaging Het
Fam136a G A 6: 86,366,685 E55K probably benign Het
Fam151a A G 4: 106,743,305 D179G probably damaging Het
Fam178b T C 1: 36,632,452 D196G probably damaging Het
Fut9 A T 4: 25,620,691 M41K probably benign Het
Gm9195 T C 14: 72,456,682 Q1531R probably null Het
Gpr6 A T 10: 41,070,872 V238D probably damaging Het
Hoxa2 A T 6: 52,163,303 S234R probably benign Het
Itga4 A G 2: 79,272,993 T143A probably benign Het
Kcnq2 A G 2: 181,081,589 S693P probably benign Het
Kif13b A G 14: 64,803,658 I1732V probably benign Het
Klhl14 A G 18: 21,652,154 V72A probably benign Het
Krt2 T A 15: 101,814,519 D348V probably benign Het
Map4k2 A T 19: 6,344,064 E300D probably benign Het
Mars A G 10: 127,302,810 probably null Het
Mpo A G 11: 87,797,577 D354G probably benign Het
Mrpl15 T C 1: 4,777,555 T174A probably damaging Het
Myom2 G A 8: 15,122,450 C1183Y probably damaging Het
Nfkb2 C A 19: 46,308,643 Q336K possibly damaging Het
Nlrp2 A G 7: 5,317,469 probably null Het
Nlrp9b T C 7: 20,019,200 L10P probably damaging Het
Nrip2 A G 6: 128,400,269 S53G probably benign Het
Olfr1280 T C 2: 111,315,932 I151T probably benign Het
Olfr1537 C T 9: 39,237,681 V248I probably benign Het
Olfr535 G A 7: 140,492,999 M120I probably damaging Het
Olfr618 C T 7: 103,597,528 L71F probably benign Het
Olfr69 A G 7: 103,767,470 M309T probably benign Het
Olfr921 A T 9: 38,775,495 K80I probably damaging Het
Pak7 A G 2: 136,116,305 S288P probably damaging Het
Pjvk T C 2: 76,657,465 F234L probably benign Het
Plekhm2 T C 4: 141,631,347 N616D probably benign Het
Pnkp C T 7: 44,857,428 R9C probably damaging Het
Prom1 A G 5: 44,055,930 C154R probably damaging Het
Rab3gap2 T A 1: 185,282,382 W1243R probably benign Het
Rad17 C T 13: 100,629,466 A385T probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rnf213 T C 11: 119,458,484 C3804R Het
Ros1 T A 10: 52,169,976 T153S probably benign Het
Sema4g T C 19: 44,997,571 S284P probably damaging Het
Sept9 C T 11: 117,199,745 probably benign Het
Slc2a9 T C 5: 38,417,226 S236G probably damaging Het
Slc9c1 T C 16: 45,577,893 F674L probably benign Het
Slfn5 A T 11: 82,958,759 K361N probably damaging Het
Smad6 A G 9: 64,021,770 L88S unknown Het
Smarca4 T A 9: 21,639,075 probably null Het
Smg7 A T 1: 152,859,489 N198K probably damaging Het
Sorcs1 G A 19: 50,152,796 Q1166* probably null Het
Stap1 A G 5: 86,090,995 N212S possibly damaging Het
Tbx2 C G 11: 85,833,312 A69G possibly damaging Het
Tmc1 C A 19: 20,907,008 D23Y probably damaging Het
Tmf1 A T 6: 97,158,494 D940E probably benign Het
Trim27 T A 13: 21,180,600 C36S probably damaging Het
Unc80 G A 1: 66,521,537 G808D probably damaging Het
Usp17ld G T 7: 103,250,887 Y279* probably null Het
Usp40 G A 1: 87,986,072 A433V probably benign Het
Vmn1r49 G A 6: 90,072,861 A53V probably benign Het
Vmn1r84 T C 7: 12,361,860 N302S probably benign Het
Wfdc2 A T 2: 164,565,821 I137L probably benign Het
Other mutations in Cfap157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cfap157 APN 2 32781383 missense probably damaging 1.00
IGL00852:Cfap157 APN 2 32779815 missense possibly damaging 0.89
IGL01284:Cfap157 APN 2 32781479 missense possibly damaging 0.69
IGL02315:Cfap157 APN 2 32778165 missense probably benign 0.02
PIT4810001:Cfap157 UTSW 2 32781432 missense probably damaging 0.96
R0654:Cfap157 UTSW 2 32779942 missense probably damaging 1.00
R0699:Cfap157 UTSW 2 32779010 missense probably damaging 1.00
R1103:Cfap157 UTSW 2 32781398 missense probably damaging 1.00
R1123:Cfap157 UTSW 2 32777923 missense possibly damaging 0.93
R2165:Cfap157 UTSW 2 32778163 unclassified probably null
R4304:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4307:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4308:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4439:Cfap157 UTSW 2 32777865 missense probably benign 0.00
R4859:Cfap157 UTSW 2 32777542 missense probably benign 0.00
R4880:Cfap157 UTSW 2 32778249 missense probably damaging 1.00
R4917:Cfap157 UTSW 2 32779953 missense probably benign 0.19
R5808:Cfap157 UTSW 2 32780645 missense probably damaging 1.00
R6052:Cfap157 UTSW 2 32779851 missense probably damaging 1.00
R6405:Cfap157 UTSW 2 32781396 missense probably damaging 1.00
R6502:Cfap157 UTSW 2 32780678 missense probably damaging 1.00
R6647:Cfap157 UTSW 2 32779074 missense probably benign
R6959:Cfap157 UTSW 2 32784248 missense probably damaging 1.00
R7123:Cfap157 UTSW 2 32779401 missense probably damaging 0.99
R7469:Cfap157 UTSW 2 32780684 missense probably damaging 1.00
R7527:Cfap157 UTSW 2 32779878 missense possibly damaging 0.86
R7697:Cfap157 UTSW 2 32779753 missense probably benign 0.01
R7911:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
X0020:Cfap157 UTSW 2 32779855 missense probably benign 0.35
Z1177:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATGAAGCCAAGACAG -3'
(R):5'- CCTCAGGGATATGGTGGAATCTC -3'

Sequencing Primer
(F):5'- GGGCCACAGAACTGCAATGAC -3'
(R):5'- GGCTAAAGCATTATACCCATGATC -3'
Posted On2019-10-24