Incidental Mutation 'R7574:Ptprs'
ID586288
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7574 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56423538 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1144 (F1144L)
Ref Sequence ENSEMBL: ENSMUSP00000064048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223642] [ENSMUST00000223859] [ENSMUST00000225456]
PDB Structure
Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000067538
AA Change: F1144L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: F1144L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086828
AA Change: F738L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: F738L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223642
Predicted Effect probably damaging
Transcript: ENSMUST00000223859
AA Change: F738L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000225456
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,942 V240A probably damaging Het
A930009A15Rik C T 10: 115,570,114 probably benign Het
Aarsd1 A G 11: 101,411,144 I201T probably damaging Het
Acaca T A 11: 84,261,588 Y854N probably benign Het
Adra2c T C 5: 35,280,415 L177P probably damaging Het
Akr1c12 A T 13: 4,279,310 I16N probably damaging Het
Aldh8a1 A T 10: 21,380,830 I47F possibly damaging Het
Birc6 A G 17: 74,579,884 I736V probably benign Het
Bmp2 A T 2: 133,560,897 M123L probably benign Het
C1ql1 T C 11: 102,945,986 Y159C probably damaging Het
Ccdc148 T C 2: 58,823,633 Y502C probably damaging Het
Ccdc155 A T 7: 45,204,611 H31Q possibly damaging Het
Cenpf A T 1: 189,658,667 N989K probably damaging Het
Ciz1 A G 2: 32,367,368 M142V probably benign Het
Cnot4 T C 6: 35,053,004 R320G possibly damaging Het
Cyth1 G T 11: 118,182,863 H215N probably damaging Het
Dapk1 G A 13: 60,761,173 G1200D probably damaging Het
Dhps A G 8: 85,072,552 Y103C probably damaging Het
Dnah1 T A 14: 31,319,908 E35D probably benign Het
Dnajb9 A T 12: 44,207,386 D79E probably damaging Het
Eif4a2 T C 16: 23,110,127 F164S probably benign Het
Enpp2 T C 15: 54,851,417 T595A probably benign Het
Exoc6b T A 6: 84,791,384 probably null Het
Fam171a1 T C 2: 3,220,354 S286P probably damaging Het
Fam35a C T 14: 34,237,466 S853N probably damaging Het
Fermt2 T A 14: 45,469,325 N338I probably damaging Het
Fhdc1 A G 3: 84,446,131 F596L probably benign Het
Fry T C 5: 150,380,894 V583A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdap1 T A 1: 17,161,441 F337I possibly damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm14085 A T 2: 122,522,844 I502F not run Het
Gm35339 T A 15: 76,357,749 Y747* probably null Het
Gm8251 A T 1: 44,059,433 V835E possibly damaging Het
Gpr6 A T 10: 41,070,656 I310N possibly damaging Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Hexa T C 9: 59,563,984 V507A probably benign Het
Hmcn2 A T 2: 31,455,519 H4718L possibly damaging Het
Hrh4 T C 18: 13,021,913 F170L possibly damaging Het
Ica1 T C 6: 8,658,266 T284A probably benign Het
Itga5 T C 15: 103,350,449 N774S probably damaging Het
Itgb2 T C 10: 77,560,158 S556P probably benign Het
Kcnq4 A G 4: 120,711,368 F384L probably benign Het
Lama2 A T 10: 27,006,730 N2612K probably benign Het
Lnx1 T C 5: 74,685,438 E117G probably benign Het
Lrrc14b G T 13: 74,360,773 A505E probably damaging Het
Ly6g T C 15: 75,158,564 I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgpre C T 7: 143,781,350 V139M probably damaging Het
Muc4 T A 16: 32,753,411 S1096T probably benign Het
Myrfl G A 10: 116,831,525 R337* probably null Het
Ndufa4 C T 6: 11,906,093 V20I probably benign Het
Nf1 A G 11: 79,408,769 D241G probably null Het
Nid1 A G 13: 13,468,443 D322G probably benign Het
Nova1 A T 12: 46,700,761 D244E unknown Het
Olfr1022 A G 2: 85,869,006 K138R probably benign Het
Olfr1240 T C 2: 89,439,401 K293E possibly damaging Het
Olfr743 T A 14: 50,534,313 D300E probably benign Het
Padi2 C A 4: 140,949,337 N595K possibly damaging Het
Pag1 A G 3: 9,693,891 I389T probably damaging Het
Pcdh10 G T 3: 45,381,375 G708V possibly damaging Het
Pecam1 A G 11: 106,699,784 S55P probably damaging Het
Plin3 A T 17: 56,284,192 V196E possibly damaging Het
Plxdc1 A T 11: 97,956,490 L119Q possibly damaging Het
Pnliprp1 A T 19: 58,738,249 N346I probably damaging Het
Ppp1r27 A T 11: 120,551,030 Y8* probably null Het
Prg3 A T 2: 84,989,402 D80V probably damaging Het
Prmt5 T C 14: 54,507,890 N607D possibly damaging Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rap1gds1 T A 3: 138,956,215 R427* probably null Het
Recql5 A G 11: 115,928,422 V106A probably benign Het
Resp18 T C 1: 75,273,971 T155A probably benign Het
Rfx6 A G 10: 51,681,818 D129G probably benign Het
Rsf1 T A 7: 97,661,167 I368K Het
Sema6a C G 18: 47,291,164 V226L probably damaging Het
Sf1 A G 19: 6,372,204 E220G probably damaging Het
Sidt1 T A 16: 44,259,485 Y602F probably damaging Het
Slc17a8 A G 10: 89,592,146 I273T probably benign Het
Slc41a1 A T 1: 131,839,151 I136F probably damaging Het
Snrpb T C 2: 130,177,019 I51V probably benign Het
Sprr2f T A 3: 92,365,947 C18S unknown Het
Stab1 T C 14: 31,154,665 N864S probably benign Het
Svil C A 18: 5,095,188 T1457K probably benign Het
Syt1 A T 10: 108,504,401 I352N probably damaging Het
Tas2r119 A G 15: 32,178,133 K282E probably damaging Het
Timeless T C 10: 128,244,669 F473S probably damaging Het
Tmc3 A G 7: 83,598,273 D192G probably damaging Het
Trmt1l T A 1: 151,440,840 I184N possibly damaging Het
Ttll6 G A 11: 96,134,875 V61M probably damaging Het
Ttn C T 2: 76,802,411 E14100K probably damaging Het
Txndc2 T A 17: 65,638,625 I186F possibly damaging Het
Ubr1 A T 2: 120,873,191 S1553T possibly damaging Het
Vmn1r208 T C 13: 22,772,535 N264S probably benign Het
Vmn1r87 T A 7: 13,131,686 M225L probably benign Het
Vmn2r101 T A 17: 19,611,637 C632S possibly damaging Het
Zfp474 T C 18: 52,639,189 S305P probably benign Het
Zfp59 A G 7: 27,853,438 N105S probably benign Het
Zfp804b T A 5: 6,772,301 Y254F possibly damaging Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 splice site probably null
R0240:Ptprs UTSW 17 56436087 splice site probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7851:Ptprs UTSW 17 56425482 missense probably benign
R7903:Ptprs UTSW 17 56424960 nonsense probably null
R8013:Ptprs UTSW 17 56435994 missense probably damaging 1.00
R8014:Ptprs UTSW 17 56435994 missense probably damaging 1.00
R8094:Ptprs UTSW 17 56428947 missense probably benign 0.01
R8112:Ptprs UTSW 17 56434532 nonsense probably null
R8181:Ptprs UTSW 17 56429064 missense probably damaging 1.00
R8511:Ptprs UTSW 17 56447440 missense probably damaging 1.00
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Z1176:Ptprs UTSW 17 56417050 missense possibly damaging 0.82
Z1176:Ptprs UTSW 17 56422211 nonsense probably null
Z1176:Ptprs UTSW 17 56434468 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGTTCCCAGGATGGAAGAC -3'
(R):5'- TTGAGGGATGCACAGGACAC -3'

Sequencing Primer
(F):5'- TTCCCAGGATGGAAGACAGCTG -3'
(R):5'- ACTGAGATCTGGCACGCCATG -3'
Posted On2019-10-24