Incidental Mutation 'R7594:Dnajb1'
ID587628
Institutional Source Beutler Lab
Gene Symbol Dnajb1
Ensembl Gene ENSMUSG00000005483
Gene NameDnaJ heat shock protein family (Hsp40) member B1
Synonyms0610007I11Rik, Hsp40
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83608193-83612653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83609844 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 81 (S81N)
Ref Sequence ENSEMBL: ENSMUSP00000005620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005620] [ENSMUST00000212300]
Predicted Effect probably benign
Transcript: ENSMUST00000005620
AA Change: S81N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005620
Gene: ENSMUSG00000005483
AA Change: S81N

DomainStartEndE-ValueType
DnaJ 3 60 1.07e-31 SMART
low complexity region 68 91 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:DnaJ_C 164 323 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212300
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. The encoded protein may also inhibit apoptosis. Peritoneal macrophages derived from homozygous knockout mice for this gene exhibit impaired heat tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal; however, homozygous null peritoneal macrophages display impaired thermotolerance in the early (but not in the late) phase after mild heat treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Dnajb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Dnajb1 APN 8 83608474 missense probably damaging 0.99
R2381:Dnajb1 UTSW 8 83610342 missense possibly damaging 0.95
R5027:Dnajb1 UTSW 8 83610103 missense probably benign 0.00
R5379:Dnajb1 UTSW 8 83608506 missense possibly damaging 0.87
R7014:Dnajb1 UTSW 8 83610255 missense probably damaging 1.00
R7243:Dnajb1 UTSW 8 83610764 missense probably damaging 0.99
R7386:Dnajb1 UTSW 8 83610303 missense probably benign 0.24
R7733:Dnajb1 UTSW 8 83608377 missense probably benign 0.11
R7852:Dnajb1 UTSW 8 83610205 missense probably benign 0.00
R7935:Dnajb1 UTSW 8 83610205 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTTACGTGGCATTGACAG -3'
(R):5'- CAAAGTTCATGTTGGTGAAGCC -3'

Sequencing Primer
(F):5'- TCTGGAACTTGCAGAGATCAGTC -3'
(R):5'- GTGAAGCCACCCATACCCATTG -3'
Posted On2019-10-24