Incidental Mutation 'R7647:Ccdc86'
ID590617
Institutional Source Beutler Lab
Gene Symbol Ccdc86
Ensembl Gene ENSMUSG00000024732
Gene Namecoiled-coil domain containing 86
Synonyms4933411H20Rik, 6720480F16Rik, D19Ertd678e, cyclon
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10941481-10949266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10948999 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 79 (S79P)
Ref Sequence ENSEMBL: ENSMUSP00000025639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025639]
Predicted Effect unknown
Transcript: ENSMUST00000025639
AA Change: S79P
SMART Domains Protein: ENSMUSP00000025639
Gene: ENSMUSG00000024732
AA Change: S79P

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
coiled coil region 338 389 N/A INTRINSIC
low complexity region 392 400 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are embryonic lethal. CD4 T cells in heterozygote mice are resistant to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Ccdc86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Ccdc86 APN 19 10943192 missense possibly damaging 0.61
R4453:Ccdc86 UTSW 19 10948519 missense probably damaging 1.00
R5541:Ccdc86 UTSW 19 10948554 missense probably damaging 1.00
R6180:Ccdc86 UTSW 19 10948581 missense possibly damaging 0.63
R6471:Ccdc86 UTSW 19 10948879 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGTCTGCATCCTGTCTAGG -3'
(R):5'- GGCCTAAAACCTCTGTCTCCAG -3'

Sequencing Primer
(F):5'- TGTCTAGGACCGGGTGATCC -3'
(R):5'- TGTCTCCAGAAAACCTTCCTG -3'
Posted On2019-10-24