Incidental Mutation 'R7647:Sp100'
ID590578
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Namenuclear antigen Sp100
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location85649988-85709998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85692043 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 353 (K353E)
Ref Sequence ENSEMBL: ENSMUSP00000066399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066427] [ENSMUST00000132641] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066427
AA Change: K353E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222
AA Change: K353E

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132641
SMART Domains Protein: ENSMUSP00000120267
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
SAND 19 92 8.85e-38 SMART
low complexity region 101 114 N/A INTRINSIC
PHD 117 159 5.97e-3 SMART
BROMO 184 284 5.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147552
AA Change: K335E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222
AA Change: K335E

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155094
AA Change: K353E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222
AA Change: K353E

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85670020 missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85666929 missense probably benign 0.01
IGL02192:Sp100 APN 1 85708001 missense probably damaging 0.99
IGL02809:Sp100 APN 1 85681124 missense probably damaging 0.99
IGL03274:Sp100 APN 1 85707304 intron probably benign
PIT4458001:Sp100 UTSW 1 85708116 missense probably benign 0.10
R0115:Sp100 UTSW 1 85650131 splice site probably benign
R0599:Sp100 UTSW 1 85681110 missense possibly damaging 0.68
R0620:Sp100 UTSW 1 85659867 splice site probably null
R0693:Sp100 UTSW 1 85667005 critical splice donor site probably null
R0709:Sp100 UTSW 1 85694281 missense probably damaging 0.96
R0744:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R0836:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R1175:Sp100 UTSW 1 85701420 missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85663521 splice site probably benign
R1749:Sp100 UTSW 1 85699636 missense possibly damaging 0.95
R2046:Sp100 UTSW 1 85709065 missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85681142 splice site probably null
R2441:Sp100 UTSW 1 85703489 unclassified probably benign
R3933:Sp100 UTSW 1 85681109 missense probably benign 0.29
R4171:Sp100 UTSW 1 85706841 missense probably benign 0.00
R4762:Sp100 UTSW 1 85701458 makesense probably null
R4863:Sp100 UTSW 1 85705003 missense probably benign 0.03
R5156:Sp100 UTSW 1 85673683 missense probably damaging 1.00
R5273:Sp100 UTSW 1 85709104 missense possibly damaging 0.86
R5635:Sp100 UTSW 1 85682264 intron probably benign
R5810:Sp100 UTSW 1 85665285 missense probably benign 0.12
R5910:Sp100 UTSW 1 85681140 critical splice donor site probably null
R5931:Sp100 UTSW 1 85679083 missense probably damaging 1.00
R7466:Sp100 UTSW 1 85707239 missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85681139 nonsense probably null
R7851:Sp100 UTSW 1 85706926 missense probably benign 0.12
R7908:Sp100 UTSW 1 85708067 missense possibly damaging 0.51
R7934:Sp100 UTSW 1 85706926 missense probably benign 0.12
R7989:Sp100 UTSW 1 85708067 missense possibly damaging 0.51
R8064:Sp100 UTSW 1 85681139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGTTAAATATCAAAGACTTGTT -3'
(R):5'- ATCGTTGGTCCCTTTCCAGATATA -3'

Sequencing Primer
(F):5'- GCTTTTTACAAGTAGAGCATAG -3'
(R):5'- CCCTTTCCAGATATACTTTGGAAAC -3'
Posted On2019-10-24