Incidental Mutation 'R7732:Ptpn4'
ID595881
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7732 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119692802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 488 (V488G)
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435]
Predicted Effect probably benign
Transcript: ENSMUST00000064091
AA Change: V488G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: V488G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163435
AA Change: V488G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: V488G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A T 15: 91,191,248 S121T possibly damaging Het
Alpk1 T C 3: 127,684,392 M69V Het
Ap3m2 G T 8: 22,797,089 D192E probably benign Het
Arel1 A G 12: 84,927,889 V493A probably benign Het
Arhgap27 T C 11: 103,340,043 H140R probably benign Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Brd4 C A 17: 32,221,412 A318S unknown Het
Cabp4 T A 19: 4,135,995 T270S probably benign Het
Cd22 G A 7: 30,870,057 R545C probably damaging Het
Cdc23 C A 18: 34,636,702 probably null Het
Chst4 G A 8: 110,029,882 Q450* probably null Het
Ctsc G A 7: 88,297,159 R132Q probably damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Cyp2b19 A G 7: 26,771,344 D470G possibly damaging Het
Dcc C T 18: 71,446,435 G689D probably benign Het
Disc1 G T 8: 125,250,975 G779* probably null Het
Dock1 T G 7: 134,744,970 D210E probably benign Het
Dynlt1a A G 17: 6,314,945 V14A probably benign Het
Epha10 A G 4: 124,915,299 D779G Het
Eprs A G 1: 185,372,939 H137R probably benign Het
Eps15l1 A C 8: 72,380,976 L447R probably damaging Het
Esyt1 A G 10: 128,521,825 probably null Het
Fam221a A G 6: 49,372,629 K43E probably benign Het
Fanci A G 7: 79,412,652 S309G possibly damaging Het
Fbxo48 T A 11: 16,953,601 W76R probably damaging Het
Fgd4 A G 16: 16,484,595 V32A probably benign Het
Foxe1 A T 4: 46,345,287 D365V unknown Het
Gabrd C T 4: 155,385,618 R378H probably benign Het
Gm3417 A G 17: 14,967,685 V109A probably benign Het
Greb1 A G 12: 16,673,863 S1862P probably damaging Het
H2al2b T C Y: 2,720,436 H80R possibly damaging Het
Hectd4 T C 5: 121,336,629 V2771A probably benign Het
Hoxa11 A T 6: 52,243,435 F289L probably damaging Het
Hsp90aa1 A G 12: 110,693,418 V412A probably damaging Het
Igsf11 A G 16: 39,008,798 Q77R probably damaging Het
Lrig1 C A 6: 94,626,377 M263I probably benign Het
Ms4a14 C T 19: 11,301,683 M1170I probably benign Het
Ndufs7 G A 10: 80,253,784 probably null Het
Nectin4 A T 1: 171,386,678 E467V probably benign Het
Olfr933 A G 9: 38,976,264 E196G probably damaging Het
Otogl G A 10: 107,806,664 H1302Y probably benign Het
Pigg A G 5: 108,318,975 S241G probably benign Het
Pom121l12 T A 11: 14,599,843 V183D probably damaging Het
Prickle2 T A 6: 92,411,224 E455V probably damaging Het
Ranbp10 A G 8: 105,773,091 I502T probably benign Het
Raph1 T A 1: 60,533,288 Q40L possibly damaging Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Serpinb6b G A 13: 32,968,607 S33N probably damaging Het
Serpinb6d A G 13: 33,669,099 N158S probably benign Het
Serping1 A T 2: 84,770,104 V298D probably damaging Het
Sgsm1 T A 5: 113,266,330 H637L probably benign Het
Sh3rf2 G T 18: 42,101,688 V179L probably damaging Het
Slc1a3 T C 15: 8,650,988 T129A probably benign Het
Slit1 T A 19: 41,604,408 Y1202F probably benign Het
Spsb2 T C 6: 124,809,693 S130P probably damaging Het
Sulf1 A G 1: 12,842,789 D749G probably benign Het
Taok3 A G 5: 117,193,748 E10G possibly damaging Het
Tbl3 G T 17: 24,704,162 A368D probably benign Het
Tdh T A 14: 63,496,058 H127L probably damaging Het
Tmem205 C A 9: 21,927,407 probably null Het
Tmem30a A C 9: 79,780,544 F114L possibly damaging Het
Tmem55b C T 14: 50,930,633 G48D possibly damaging Het
Tmprss15 T C 16: 79,003,420 K607E probably benign Het
Tnxb A T 17: 34,694,280 D1756V probably damaging Het
Trhde A G 10: 114,788,064 F312L probably benign Het
Ttn G A 2: 76,826,449 P12494L probably null Het
Vmn2r61 A G 7: 42,266,673 R237G probably benign Het
Vps13c A T 9: 67,940,516 N2187Y probably damaging Het
Wdr64 A G 1: 175,789,929 T692A probably benign Het
Whamm A G 7: 81,571,424 N35D probably damaging Het
Wnt2 T C 6: 18,023,336 S105G probably damaging Het
Zfp108 T A 7: 24,261,527 H514Q probably benign Het
Znfx1 T C 2: 167,042,669 K888E possibly damaging Het
Zzz3 T C 3: 152,448,842 Y577H probably damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCAACACTAGGTACTGATGCATC -3'
(R):5'- ACATAGTTGGTATCTGGTGCTTTAC -3'

Sequencing Primer
(F):5'- ACTGATGCATCTTATGGAGTCTACC -3'
(R):5'- GGTGCTTTACCTAATTTAGAAAAAGG -3'
Posted On2019-11-12