Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Ptpn4'

396972

Institutional Source

Beutler Lab

Gene Symbol

Ptpn4

Ensembl Gene

ENSMUSG00000026384

Gene Name

protein tyrosine phosphatase, non-receptor type 4

Synonyms

TEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119652467-119837613 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 119707863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 370 (W370*)

Ref Sequence

ENSEMBL: ENSMUSP00000127713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435]

AlphaFold

Q9WU22

Predicted Effect

probably null
Transcript: ENSMUST00000064091
AA Change: W370*

SMART Domains

Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: W370*

Domain	Start	End	E-Value	Type
B41	25	222	7.33e-80	SMART
FERM_C	226	316	6.48e-34	SMART
FA	322	368	3.28e-12	SMART
PDZ	526	605	2.47e-14	SMART
PTPc	654	913	1.38e-120	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000163435
AA Change: W370*

SMART Domains

Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: W370*

Domain	Start	End	E-Value	Type
B41	25	222	7.33e-80	SMART
FERM_C	226	316	6.48e-34	SMART
FA	322	368	3.28e-12	SMART
PDB:3NFL\|D	499	552	4e-30	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000164269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168808

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Ptpn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Ptpn4	APN	1	119659925	splice site	probably benign
IGL00885:Ptpn4	APN	1	119802363	missense	possibly damaging	0.95
IGL00973:Ptpn4	APN	1	119741371	missense	probably benign	0.00
IGL01867:Ptpn4	APN	1	119675599	missense	probably benign
IGL01870:Ptpn4	APN	1	119675547	critical splice donor site	probably null
IGL02101:Ptpn4	APN	1	119687678	missense	probably damaging	1.00
IGL02344:Ptpn4	APN	1	119773260	missense	probably damaging	1.00
IGL02348:Ptpn4	APN	1	119682722	missense	probably damaging	1.00
IGL02693:Ptpn4	APN	1	119715969	missense	probably damaging	0.96
IGL03281:Ptpn4	APN	1	119659912	missense	probably damaging	1.00
alto	UTSW	1	119684581	nonsense	probably null
blinding	UTSW	1	119721862	critical splice donor site	probably null
botched	UTSW	1	119743390	missense	probably damaging	1.00
bungled	UTSW	1	119687605	splice site	probably null
Fovea	UTSW	1	119678822	missense	possibly damaging	0.81
hash	UTSW	1	119765919	nonsense	probably null
Hoechter	UTSW	1	119680059	missense	probably damaging	1.00
Lumens	UTSW	1	119667548	missense	probably damaging	1.00
BB008:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
BB018:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0504:Ptpn4	UTSW	1	119765915	missense	probably damaging	1.00
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1148:Ptpn4	UTSW	1	119675709	splice site	probably benign
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1662:Ptpn4	UTSW	1	119765058	missense	probably damaging	0.96
R1694:Ptpn4	UTSW	1	119783510	missense	probably damaging	0.99
R1733:Ptpn4	UTSW	1	119716043	splice site	probably null
R2083:Ptpn4	UTSW	1	119687759	missense	possibly damaging	0.63
R2226:Ptpn4	UTSW	1	119682785	missense	probably damaging	1.00
R2276:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R2277:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R3123:Ptpn4	UTSW	1	119765423	splice site	probably null
R3425:Ptpn4	UTSW	1	119707830	missense	probably benign	0.02
R4568:Ptpn4	UTSW	1	119680059	missense	probably damaging	1.00
R4716:Ptpn4	UTSW	1	119721868	missense	probably damaging	1.00
R4819:Ptpn4	UTSW	1	119659850	missense	probably benign
R4959:Ptpn4	UTSW	1	119765096	nonsense	probably null
R5345:Ptpn4	UTSW	1	119765477	missense	probably benign
R5471:Ptpn4	UTSW	1	119765919	nonsense	probably null
R5826:Ptpn4	UTSW	1	119684516	missense	probably benign	0.32
R5933:Ptpn4	UTSW	1	119687723	missense	probably damaging	0.97
R6075:Ptpn4	UTSW	1	119765136	missense	probably damaging	1.00
R6286:Ptpn4	UTSW	1	119721862	critical splice donor site	probably null
R6389:Ptpn4	UTSW	1	119721954	missense	probably damaging	0.97
R6392:Ptpn4	UTSW	1	119773123	missense	probably benign
R6769:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6771:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6794:Ptpn4	UTSW	1	119743390	missense	probably damaging	1.00
R6933:Ptpn4	UTSW	1	119773148	intron	probably benign
R6967:Ptpn4	UTSW	1	119684581	nonsense	probably null
R6980:Ptpn4	UTSW	1	119743421	missense	possibly damaging	0.86
R7150:Ptpn4	UTSW	1	119691745	critical splice donor site	probably null
R7247:Ptpn4	UTSW	1	119690034	makesense	probably null
R7283:Ptpn4	UTSW	1	119682531	missense	possibly damaging	0.90
R7459:Ptpn4	UTSW	1	119659834	missense	probably damaging	0.99
R7732:Ptpn4	UTSW	1	119692802	missense	probably benign
R7794:Ptpn4	UTSW	1	119726037	missense	probably damaging	1.00
R8061:Ptpn4	UTSW	1	119691600	critical splice donor site	probably null
R8236:Ptpn4	UTSW	1	119678822	missense	possibly damaging	0.81
R8929:Ptpn4	UTSW	1	119667548	missense	probably damaging	1.00
R8979:Ptpn4	UTSW	1	119743390	missense	probably damaging	1.00
R9334:Ptpn4	UTSW	1	119802384	missense	probably benign
RF014:Ptpn4	UTSW	1	119684465	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGCAATGTTTGAGGCAAC -3'
(R):5'- CTGAGTACAGTAGCTACAAGCAAAG -3'

Sequencing Primer
(F):5'- CAAGCCTGAGTACTTGGTTGCAATC -3'
(R):5'- TGCAATTTGAGAAAATGTTTGATAGC -3'

Posted On

2016-06-21