Incidental Mutation 'R8061:Ptpn4'
ID619681
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R8061 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 119691600 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435] [ENSMUST00000166624]
Predicted Effect probably benign
Transcript: ENSMUST00000064091
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163435
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Predicted Effect probably benign
Transcript: ENSMUST00000166624
SMART Domains Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
Blast:PTPc 1 65 1e-34 BLAST
PDB:2I75|A 15 67 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTAACTGCCACTCCATCTCAA -3'
(R):5'- TGAAAATGGAAGGTTTGGATTCAA -3'

Sequencing Primer
(F):5'- AACACTGCATTCTGAGCTCTGAGG -3'
(R):5'- TCAATGTAAAGGTAATCCAGAACG -3'
Posted On2020-01-23