Incidental Mutation 'R7738:Olig2'
ID596393
Institutional Source Beutler Lab
Gene Symbol Olig2
Ensembl Gene ENSMUSG00000039830
Gene Nameoligodendrocyte transcription factor 2
SynonymsBhlhb1, bHLHe19, RK17, Olg-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7738 (G1)
Quality Score149.008
Status Not validated
Chromosome16
Chromosomal Location91225457-91228677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91227160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 254 (I254T)
Ref Sequence ENSEMBL: ENSMUSP00000036797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035608]
Predicted Effect unknown
Transcript: ENSMUST00000035608
AA Change: I254T
SMART Domains Protein: ENSMUSP00000036797
Gene: ENSMUSG00000039830
AA Change: I254T

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
HLH 114 168 5.28e-14 SMART
low complexity region 192 254 N/A INTRINSIC
low complexity region 259 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, impaired development of motoneurons and oligodendrocytes, aphagia, hypotonia, and abnormal posture and breathing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Olig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02322:Olig2 APN 16 91226658 missense probably benign 0.04
R2367:Olig2 UTSW 16 91226566 missense possibly damaging 0.84
R4537:Olig2 UTSW 16 91226844 missense probably damaging 0.99
R5597:Olig2 UTSW 16 91226880 missense probably benign 0.11
R6612:Olig2 UTSW 16 91226881 missense probably damaging 0.99
R6626:Olig2 UTSW 16 91227156 missense unknown
R7081:Olig2 UTSW 16 91226419 missense probably damaging 0.97
R7352:Olig2 UTSW 16 91226689 missense probably benign 0.08
R8076:Olig2 UTSW 16 91226411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTGGTGAGCGAGATCTAC -3'
(R):5'- AGCTCCCCTTCTTGCAACAG -3'

Sequencing Primer
(F):5'- AGATCTACGGGGGTCACCAC -3'
(R):5'- TTCTTGCAACAGAGCCCCG -3'
Posted On2019-11-26