Incidental Mutation 'R7752:Zfp738'
ID597319
Institutional Source Beutler Lab
Gene Symbol Zfp738
Ensembl Gene ENSMUSG00000048280
Gene Namezinc finger protein 738
Synonyms6720487G11Rik, 3830402I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67658685-67687071 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 67672991 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 79 (L79*)
Ref Sequence ENSEMBL: ENSMUSP00000135683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]
Predicted Effect probably benign
Transcript: ENSMUST00000110973
SMART Domains Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 2 62 1.97e-31 SMART
SCOP:d1fgja_ 76 119 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125495
AA Change: L79*
SMART Domains Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280
AA Change: L79*

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137496
SMART Domains Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
ZnF_C2H2 91 111 3.13e1 SMART
ZnF_C2H2 119 141 9.56e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 8.34e-3 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
ZnF_C2H2 343 365 8.34e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
ZnF_C2H2 567 589 5.42e-2 SMART
ZnF_C2H2 595 617 7.78e-3 SMART
ZnF_C2H2 623 645 2.05e-2 SMART
ZnF_C2H2 651 673 2.57e-3 SMART
ZnF_C2H2 679 701 7.26e-3 SMART
ZnF_C2H2 735 757 5.42e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175678
AA Change: L89*
SMART Domains Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280
AA Change: L89*

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175821
SMART Domains Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
ZnF_C2H2 81 101 3.13e1 SMART
ZnF_C2H2 109 131 9.56e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 3.21e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Zfp738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zfp738 APN 13 67683401 critical splice donor site probably null
IGL01734:Zfp738 APN 13 67683444 utr 5 prime probably benign
IGL01980:Zfp738 APN 13 67669977 missense possibly damaging 0.80
IGL02052:Zfp738 APN 13 67671481 missense possibly damaging 0.87
IGL02330:Zfp738 APN 13 67671431 missense probably damaging 0.99
IGL02686:Zfp738 APN 13 67673652 missense probably damaging 1.00
I2505:Zfp738 UTSW 13 67673067 missense probably benign 0.36
R0219:Zfp738 UTSW 13 67683389 intron probably benign
R0491:Zfp738 UTSW 13 67670021 missense possibly damaging 0.87
R0722:Zfp738 UTSW 13 67671524 missense probably benign 0.09
R1116:Zfp738 UTSW 13 67670243 splice site probably null
R1425:Zfp738 UTSW 13 67670775 missense possibly damaging 0.77
R1854:Zfp738 UTSW 13 67670357 missense probably damaging 1.00
R2095:Zfp738 UTSW 13 67671303 missense probably damaging 1.00
R2171:Zfp738 UTSW 13 67670977 nonsense probably null
R2180:Zfp738 UTSW 13 67671194 missense probably damaging 1.00
R2225:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2226:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2907:Zfp738 UTSW 13 67670112 missense probably benign 0.33
R3605:Zfp738 UTSW 13 67671389 nonsense probably null
R4731:Zfp738 UTSW 13 67669914 missense probably damaging 1.00
R5037:Zfp738 UTSW 13 67670201 missense probably damaging 1.00
R5223:Zfp738 UTSW 13 67673063 missense probably damaging 0.99
R5259:Zfp738 UTSW 13 67669686 missense probably benign
R5358:Zfp738 UTSW 13 67671012 missense probably damaging 0.98
R6404:Zfp738 UTSW 13 67671060 missense possibly damaging 0.89
R6874:Zfp738 UTSW 13 67670263 missense possibly damaging 0.93
R7041:Zfp738 UTSW 13 67670301 missense probably damaging 1.00
R7172:Zfp738 UTSW 13 67670408 missense probably damaging 1.00
R7178:Zfp738 UTSW 13 67673028 missense probably damaging 1.00
R7308:Zfp738 UTSW 13 67669553 missense probably benign 0.00
R7386:Zfp738 UTSW 13 67670250 missense probably damaging 1.00
R7453:Zfp738 UTSW 13 67670355 missense probably benign 0.42
R7456:Zfp738 UTSW 13 67669500 missense probably damaging 1.00
R7467:Zfp738 UTSW 13 67672961 missense probably benign 0.03
R7615:Zfp738 UTSW 13 67670203 missense probably damaging 0.96
R7663:Zfp738 UTSW 13 67683401 critical splice donor site probably null
R7901:Zfp738 UTSW 13 67672991 nonsense probably null
R8042:Zfp738 UTSW 13 67670891 missense probably damaging 0.98
R8288:Zfp738 UTSW 13 67670789 missense possibly damaging 0.88
R8340:Zfp738 UTSW 13 67671112 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGATCTTTGGCTGTCCTG -3'
(R):5'- ATATACACAGTCTGGAAAGGACC -3'

Sequencing Primer
(F):5'- GTCCTGGGGAACACAAGTTAATATC -3'
(R):5'- GGAAAGGACCATTTTATTTTCCAGG -3'
Posted On2019-11-26