Incidental Mutation 'R7754:Efcab9'
ID597453
Institutional Source Beutler Lab
Gene Symbol Efcab9
Ensembl Gene ENSMUSG00000044056
Gene NameEF-hand calcium binding domain 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location32522751-32532081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32522941 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 169 (T169A)
Ref Sequence ENSEMBL: ENSMUSP00000060205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054327] [ENSMUST00000109377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054327
AA Change: T169A

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060205
Gene: ENSMUSG00000044056
AA Change: T169A

DomainStartEndE-ValueType
SCOP:d2sas__ 46 182 7e-9 SMART
Blast:EFh 63 91 1e-7 BLAST
Blast:EFh 140 170 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109377
SMART Domains Protein: ENSMUSP00000105002
Gene: ENSMUSG00000044056

DomainStartEndE-ValueType
Blast:EFh 1 26 3e-7 BLAST
SCOP:d2sas__ 2 88 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,825,505 probably null Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Efcab9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Efcab9 APN 11 32527451 missense probably damaging 1.00
IGL02419:Efcab9 APN 11 32522950 missense probably benign 0.17
PIT4366001:Efcab9 UTSW 11 32523608 missense probably damaging 1.00
R1764:Efcab9 UTSW 11 32524457 missense possibly damaging 0.88
R3081:Efcab9 UTSW 11 32523689 missense probably benign 0.01
R3751:Efcab9 UTSW 11 32527420 missense probably benign 0.05
R5237:Efcab9 UTSW 11 32522832 missense probably benign 0.01
R5375:Efcab9 UTSW 11 32527484 missense probably damaging 1.00
R5475:Efcab9 UTSW 11 32522862 missense probably damaging 0.96
R7707:Efcab9 UTSW 11 32522851 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTCTACTTCATTGTGGCCATG -3'
(R):5'- AAAATGACCCTGCTCCCATG -3'

Sequencing Primer
(F):5'- GTGGCCATGTTCATTTTAATTATCC -3'
(R):5'- CAGACTTGACTGTTCCTGGGC -3'
Posted On2019-11-26