Incidental Mutation 'R7754:Zfp827'
ID597444
Institutional Source Beutler Lab
Gene Symbol Zfp827
Ensembl Gene ENSMUSG00000071064
Gene Namezinc finger protein 827
Synonyms2810449M09Rik, D630040G17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location79028437-79193766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79190329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 511 (V511A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098614] [ENSMUST00000119254] [ENSMUST00000148713]
Predicted Effect probably benign
Transcript: ENSMUST00000098614
SMART Domains Protein: ENSMUSP00000096214
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.31e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.31e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119254
SMART Domains Protein: ENSMUSP00000113199
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.25e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.25e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129613
SMART Domains Protein: ENSMUSP00000119511
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 35 57 1.64e-1 SMART
ZnF_C2H2 67 90 7.89e0 SMART
low complexity region 97 115 N/A INTRINSIC
ZnF_C2H2 157 179 1.26e-2 SMART
ZnF_C2H2 185 207 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145827
SMART Domains Protein: ENSMUSP00000114208
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 77 99 2.4e-3 SMART
ZnF_C2H2 111 133 4.72e-2 SMART
ZnF_C2H2 163 185 1.64e-1 SMART
ZnF_C2H2 195 218 7.89e0 SMART
low complexity region 225 243 N/A INTRINSIC
ZnF_C2H2 285 307 1.26e-2 SMART
ZnF_C2H2 313 335 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148713
SMART Domains Protein: ENSMUSP00000120913
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 106 128 2.4e-3 SMART
ZnF_C2H2 134 156 4.72e-2 SMART
ZnF_C2H2 186 208 1.64e-1 SMART
ZnF_C2H2 218 241 7.89e0 SMART
low complexity region 248 266 N/A INTRINSIC
ZnF_C2H2 308 330 1.26e-2 SMART
ZnF_C2H2 336 358 3.07e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120562
Gene: ENSMUSG00000071064
AA Change: V511A

DomainStartEndE-ValueType
ZnF_C2H2 31 53 2.4e-3 SMART
ZnF_C2H2 59 81 4.72e-2 SMART
ZnF_C2H2 111 133 1.64e-1 SMART
ZnF_C2H2 143 166 7.89e0 SMART
low complexity region 173 191 N/A INTRINSIC
ZnF_C2H2 233 255 1.26e-2 SMART
ZnF_C2H2 261 283 3.07e-1 SMART
ZnF_C2H2 290 312 9.44e-2 SMART
ZnF_C2H2 317 339 4.34e-1 SMART
ZnF_C2H2 345 367 7.9e-4 SMART
ZnF_C2H2 373 396 2.53e-2 SMART
ZnF_C2H2 402 424 2.45e0 SMART
low complexity region 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Other mutations in Zfp827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Zfp827 APN 8 79060733 missense possibly damaging 0.82
IGL01545:Zfp827 APN 8 79070434 missense probably damaging 1.00
IGL01552:Zfp827 APN 8 79076191 missense probably damaging 1.00
IGL02261:Zfp827 APN 8 79180079 missense probably damaging 0.97
IGL02451:Zfp827 APN 8 79060972 missense probably damaging 1.00
IGL03130:Zfp827 APN 8 79060957 missense probably damaging 1.00
IGL03411:Zfp827 APN 8 79076487 missense probably damaging 0.99
E0354:Zfp827 UTSW 8 79136577 missense probably damaging 1.00
R0502:Zfp827 UTSW 8 79179077 splice site probably null
R0547:Zfp827 UTSW 8 79060310 missense probably damaging 1.00
R0926:Zfp827 UTSW 8 79118192 missense probably benign 0.00
R0975:Zfp827 UTSW 8 79061185 missense probably benign 0.00
R1305:Zfp827 UTSW 8 79060894 missense possibly damaging 0.95
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1638:Zfp827 UTSW 8 79076346 missense possibly damaging 0.94
R1714:Zfp827 UTSW 8 79060573 missense probably damaging 1.00
R2044:Zfp827 UTSW 8 79076236 missense probably benign
R2132:Zfp827 UTSW 8 79185721 missense possibly damaging 0.53
R3844:Zfp827 UTSW 8 79136619 missense probably damaging 0.99
R4329:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
R4629:Zfp827 UTSW 8 79060382 missense probably damaging 0.99
R4873:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4875:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4936:Zfp827 UTSW 8 79061183 missense probably benign
R4965:Zfp827 UTSW 8 79061281 missense probably benign
R5103:Zfp827 UTSW 8 79070403 missense probably damaging 1.00
R5366:Zfp827 UTSW 8 79185704 missense possibly damaging 0.94
R5794:Zfp827 UTSW 8 79070442 missense probably damaging 1.00
R5825:Zfp827 UTSW 8 79179016 missense probably damaging 1.00
R6118:Zfp827 UTSW 8 79076438 missense possibly damaging 0.75
R6236:Zfp827 UTSW 8 79070476 missense probably damaging 1.00
R6263:Zfp827 UTSW 8 79179073 missense probably damaging 1.00
R6306:Zfp827 UTSW 8 79060695 missense probably damaging 1.00
R6490:Zfp827 UTSW 8 79189977 utr 3 prime probably benign
R6497:Zfp827 UTSW 8 79180128 missense probably damaging 1.00
R7250:Zfp827 UTSW 8 79190092 missense
R7290:Zfp827 UTSW 8 79189813 missense possibly damaging 0.86
R7443:Zfp827 UTSW 8 79190418 missense
R7708:Zfp827 UTSW 8 79175962 missense probably damaging 1.00
R7836:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7919:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7995:Zfp827 UTSW 8 79118258 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAGAAAGGCCTGAGTCCAG -3'
(R):5'- TTTGGTACAGAACGCGGCTG -3'

Sequencing Primer
(F):5'- TGAGTCCAGCCTCCAGAGAG -3'
(R):5'- TACAGAACGCGGCTGTCCTC -3'
Posted On2019-11-26