Incidental Mutation 'RF020:Tsen34'
ID 603803
Institutional Source Beutler Lab
Gene Symbol Tsen34
Ensembl Gene ENSMUSG00000035585
Gene Name tRNA splicing endonuclease subunit 34
Synonyms Leng5, 0610027F08Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # RF020 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 3696086-3704034 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GGAGCCAAAAT to G at 3698795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038521] [ENSMUST00000038608] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000118710] [ENSMUST00000123088] [ENSMUST00000205287] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000137204] [ENSMUST00000142713] [ENSMUST00000155060] [ENSMUST00000205734] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
AlphaFold Q8BMZ5
Predicted Effect probably benign
Transcript: ENSMUST00000038521
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038608
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108627
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108629
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108630
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123088
SMART Domains Protein: ENSMUSP00000123614
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205287
Predicted Effect probably benign
Transcript: ENSMUST00000127106
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128364
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137204
SMART Domains Protein: ENSMUSP00000120403
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142713
SMART Domains Protein: ENSMUSP00000118440
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205734
Predicted Effect probably benign
Transcript: ENSMUST00000206343
Predicted Effect probably benign
Transcript: ENSMUST00000206379
Predicted Effect probably benign
Transcript: ENSMUST00000206571
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,132,880 (GRCm39) K1270E possibly damaging Het
Adgrb2 T C 4: 129,903,877 (GRCm39) S668P probably damaging Het
Ahdc1 T G 4: 132,791,588 (GRCm39) L943R possibly damaging Het
Ank2 T C 3: 126,739,125 (GRCm39) K2253R unknown Het
Arhgap23 T C 11: 97,354,387 (GRCm39) S767P probably damaging Het
Arhgef12 A G 9: 42,901,285 (GRCm39) I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 108,999,350 (GRCm39) probably benign Het
Btbd19 A T 4: 116,979,472 (GRCm39) C116S probably damaging Het
Cbr1 C T 16: 93,407,067 (GRCm39) A261V probably benign Het
Ccdc137 A G 11: 120,349,022 (GRCm39) R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,865,876 (GRCm39) probably benign Het
Celsr3 C T 9: 108,726,256 (GRCm39) R3162C probably benign Het
Cep350 A T 1: 155,791,224 (GRCm39) V1300E probably benign Het
Cluh G GCCAGAT 11: 74,560,364 (GRCm39) probably benign Het
Cmya5 G T 13: 93,205,799 (GRCm39) Q3357K possibly damaging Het
Col6a2 T G 10: 76,442,043 (GRCm39) probably null Het
Cyp2j9 T A 4: 96,465,889 (GRCm39) T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,892,525 (GRCm39) probably null Het
Dnah6 T A 6: 73,095,040 (GRCm39) Y2181F probably benign Het
Dnah7b A G 1: 46,412,421 (GRCm39) D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,674,169 (GRCm39) probably benign Het
Ep300 A T 15: 81,470,772 (GRCm39) probably benign Het
Fam234a A G 17: 26,437,725 (GRCm39) V90A probably benign Het
Gab3 TCT TCTGCT X: 74,043,623 (GRCm39) probably benign Het
Gal3st1 A G 11: 3,948,153 (GRCm39) Y120C possibly damaging Het
Garin5a GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,149,959 (GRCm39) probably null Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,325,030 (GRCm39) probably null Het
Gm6665 T TC 18: 31,953,430 (GRCm39) probably null Het
Hdlbp T C 1: 93,368,456 (GRCm39) T8A probably benign Het
Hnrnpa2b1 T A 6: 51,443,674 (GRCm39) K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 (GRCm39) probably benign Het
Klhl10 C G 11: 100,332,896 (GRCm39) Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,198,801 (GRCm39) probably null Het
Kmt2b CC CCTCCTGC 7: 30,285,807 (GRCm39) probably benign Het
Krt1c A G 15: 101,726,403 (GRCm39) I45T unknown Het
Ksr2 T C 5: 117,693,283 (GRCm39) S244P probably benign Het
Lama5 A T 2: 179,837,971 (GRCm39) M915K probably benign Het
Lrp1b A C 2: 41,660,858 (GRCm39) H197Q Het
Lrrc1 T C 9: 77,359,913 (GRCm39) E293G probably damaging Het
Med12l AACA AACAACA 3: 59,183,379 (GRCm39) probably benign Het
Mgam T A 6: 40,662,243 (GRCm39) Y1179N probably damaging Het
Mgat4c A G 10: 102,224,928 (GRCm39) I381V probably benign Het
Mrgprx1 A AGAC 7: 47,671,259 (GRCm39) probably benign Het
Myc A T 15: 61,857,672 (GRCm39) probably benign Het
Nipbl A G 15: 8,388,418 (GRCm39) S401P probably damaging Het
Nlrp9c A T 7: 26,084,649 (GRCm39) I310N probably benign Het
Nwd2 C A 5: 63,963,066 (GRCm39) Y883* probably null Het
Oas1e T A 5: 120,932,383 (GRCm39) T87S possibly damaging Het
Or10n7-ps1 GA GATACA 9: 39,598,049 (GRCm39) probably null Het
Or51a5 A T 7: 102,771,098 (GRCm39) C294S probably benign Het
Or52d3 A G 7: 104,229,497 (GRCm39) M215V probably benign Het
Or8b38 G A 9: 37,972,620 (GRCm39) M1I probably null Het
Pappa T G 4: 65,123,282 (GRCm39) S872R possibly damaging Het
Parp4 T C 14: 56,884,806 (GRCm39) L1295P unknown Het
Pcdh15 A T 10: 74,021,242 (GRCm39) Y152F probably damaging Het
Pdk1 A T 2: 71,714,240 (GRCm39) I217L possibly damaging Het
Phldb1 A C 9: 44,609,243 (GRCm39) C450W probably damaging Het
Pnma8a C CCATGATGCACCTGCTTCAACATCA 7: 16,695,376 (GRCm39) probably benign Het
Prl2c5 G A 13: 13,360,497 (GRCm39) G55S probably benign Het
Psme2b A T 11: 48,836,397 (GRCm39) H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,891,412 (GRCm39) probably benign Het
Rln3 T C 8: 84,769,931 (GRCm39) T73A probably benign Het
Rprd1a T A 18: 24,663,062 (GRCm39) Q21L probably damaging Het
Septin3 A T 15: 82,168,662 (GRCm39) D155V probably damaging Het
Sh3rf3 T A 10: 58,649,590 (GRCm39) V65E probably damaging Het
Shank3 A G 15: 89,384,593 (GRCm39) N155S probably benign Het
Shox2 G T 3: 66,881,146 (GRCm39) P278Q probably damaging Het
Slc1a1 T C 19: 28,856,555 (GRCm39) probably null Het
Slc39a10 A T 1: 46,849,175 (GRCm39) F814I probably damaging Het
Slc5a1 T C 5: 33,290,773 (GRCm39) I119T probably damaging Het
Slc6a13 T C 6: 121,301,310 (GRCm39) probably null Het
Spmap2l CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,164,247 (GRCm39) probably benign Het
Spta1 A G 1: 174,041,010 (GRCm39) D1270G probably benign Het
Spta1 T A 1: 174,045,469 (GRCm39) F1542L probably damaging Het
Tacc3 T A 5: 33,818,568 (GRCm39) M1K probably null Het
Tax1bp1 T C 6: 52,698,339 (GRCm39) V17A probably damaging Het
Tmem156 T A 5: 65,248,890 (GRCm39) E3D probably benign Het
Tmem209 T A 6: 30,487,417 (GRCm39) M530L probably benign Het
Trpc2 A G 7: 101,745,433 (GRCm39) D883G unknown Het
Uhrf2 T C 19: 30,063,791 (GRCm39) Y585H probably damaging Het
Vmn1r26 T A 6: 57,985,705 (GRCm39) K161N probably benign Het
Vmn1r29 A G 6: 58,284,528 (GRCm39) S83G probably benign Het
Vps13b G T 15: 35,925,552 (GRCm39) W3829L probably null Het
Vwce G A 19: 10,630,449 (GRCm39) G503R probably damaging Het
Zc3h11a T C 1: 133,554,735 (GRCm39) E415G possibly damaging Het
Zc3h14 T A 12: 98,746,541 (GRCm39) probably null Het
Zfp119b A T 17: 56,246,499 (GRCm39) M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,013,418 (GRCm39) probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,013,451 (GRCm39) probably benign Het
Zyx T A 6: 42,334,330 (GRCm39) L518Q probably damaging Het
Other mutations in Tsen34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tsen34 APN 7 3,703,530 (GRCm39) makesense probably null
R1612:Tsen34 UTSW 7 3,698,395 (GRCm39) missense probably damaging 0.99
R2441:Tsen34 UTSW 7 3,697,994 (GRCm39) missense possibly damaging 0.92
R4455:Tsen34 UTSW 7 3,698,097 (GRCm39) splice site probably null
R4702:Tsen34 UTSW 7 3,703,632 (GRCm39) missense probably damaging 1.00
R4870:Tsen34 UTSW 7 3,697,380 (GRCm39) unclassified probably benign
R5950:Tsen34 UTSW 7 3,697,787 (GRCm39) missense probably null 0.97
R6221:Tsen34 UTSW 7 3,698,543 (GRCm39) missense probably damaging 0.99
R6266:Tsen34 UTSW 7 3,696,984 (GRCm39) unclassified probably benign
R7121:Tsen34 UTSW 7 3,697,986 (GRCm39) missense probably benign 0.18
R7134:Tsen34 UTSW 7 3,703,640 (GRCm39) missense probably damaging 0.98
R7190:Tsen34 UTSW 7 3,697,806 (GRCm39) missense possibly damaging 0.94
R7345:Tsen34 UTSW 7 3,698,614 (GRCm39) missense probably damaging 1.00
R7448:Tsen34 UTSW 7 3,698,834 (GRCm39) critical splice donor site probably null
R7743:Tsen34 UTSW 7 3,697,601 (GRCm39) missense possibly damaging 0.54
R7887:Tsen34 UTSW 7 3,697,707 (GRCm39) missense probably damaging 1.00
R8723:Tsen34 UTSW 7 3,698,149 (GRCm39) missense probably benign 0.00
R8916:Tsen34 UTSW 7 3,697,340 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTGACTTCCTGGTCTATCCTG -3'
(R):5'- AATGCGCTCATATGTTTTGTGCATG -3'

Sequencing Primer
(F):5'- CCTGGTCTATCCTGGTGAGTTTG -3'
(R):5'- CATATGTTTTGTGCATGTAAGTAAGG -3'
Posted On 2019-12-04