Incidental Mutation 'RF032:Lmx1b'
ID604395
Institutional Source Beutler Lab
Gene Symbol Lmx1b
Ensembl Gene ENSMUSG00000038765
Gene NameLIM homeobox transcription factor 1 beta
SynonymsIcst, LMX1.2, GENA 191
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #RF032 (G1)
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location33560965-33640511 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA to TACATCTTGATGCCGTCCA at 33640489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041730]
Predicted Effect probably null
Transcript: ENSMUST00000041730
SMART Domains Protein: ENSMUSP00000043616
Gene: ENSMUSG00000038765

DomainStartEndE-ValueType
LIM 32 83 4.48e-17 SMART
LIM 91 145 5.51e-17 SMART
low complexity region 151 172 N/A INTRINSIC
HOX 196 258 1.51e-21 SMART
low complexity region 259 272 N/A INTRINSIC
low complexity region 328 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176067
SMART Domains Protein: ENSMUSP00000134944
Gene: ENSMUSG00000038765

DomainStartEndE-ValueType
LIM 1 38 2.23e-3 SMART
LIM 46 100 5.51e-17 SMART
low complexity region 106 127 N/A INTRINSIC
HOX 151 213 1.51e-21 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 290 302 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various skeletal, kidney, and eye defects. Pups also fail to suckle. Heterozygous mice with a homeodomain V265D mutation exhibit a variety of eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Lmx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Lmx1b APN 2 33639498 missense possibly damaging 0.95
IGL01583:Lmx1b APN 2 33569059 missense probably benign 0.04
IGL02885:Lmx1b APN 2 33567204 missense probably benign 0.10
R1926:Lmx1b UTSW 2 33564662 missense probably damaging 1.00
R3056:Lmx1b UTSW 2 33567285 nonsense probably null
R3522:Lmx1b UTSW 2 33639531 missense probably benign 0.01
R3957:Lmx1b UTSW 2 33569094 missense probably damaging 0.99
R4888:Lmx1b UTSW 2 33564790 missense probably benign 0.01
R6115:Lmx1b UTSW 2 33569106 missense probably damaging 0.96
R8254:Lmx1b UTSW 2 33565114 missense
R8787:Lmx1b UTSW 2 33639510 missense
RF035:Lmx1b UTSW 2 33640489 nonsense probably null
RF038:Lmx1b UTSW 2 33640509 start codon destroyed probably null
RF043:Lmx1b UTSW 2 33640509 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGAACGTTTTCCCCTCAGG -3'
(R):5'- CTGACAAGCAGGTGACAGGC -3'

Sequencing Primer
(F):5'- TGGTCATTCCAGGGGTCC -3'
(R):5'- CGAGTAGCCGGTAGAGAGC -3'
Posted On2019-12-04