Incidental Mutation 'R7841:Olfr1252'
ID606271
Institutional Source Beutler Lab
Gene Symbol Olfr1252
Ensembl Gene ENSMUSG00000110819
Gene Nameolfactory receptor 1252
SynonymsMOR231-22_p, GA_x6K02T2Q125-51162884-51161940
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89719575-89725012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89721965 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 49 (A49S)
Ref Sequence ENSEMBL: ENSMUSP00000150304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186710] [ENSMUST00000213196] [ENSMUST00000216203]
Predicted Effect probably benign
Transcript: ENSMUST00000186710
AA Change: A49S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: A49S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213196
AA Change: A49S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216203
AA Change: A49S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Olfr1252
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr1252 APN 2 89721526 missense probably damaging 1.00
PIT4151001:Olfr1252 UTSW 2 89721893 missense probably benign 0.42
R1838:Olfr1252 UTSW 2 89721709 missense probably damaging 0.99
R1866:Olfr1252 UTSW 2 89721206 missense probably benign 0.00
R3835:Olfr1252 UTSW 2 89721455 missense possibly damaging 0.75
R4577:Olfr1252 UTSW 2 89722043 missense possibly damaging 0.80
R4675:Olfr1252 UTSW 2 89721494 missense probably benign
R4799:Olfr1252 UTSW 2 89721362 missense probably benign 0.24
R4845:Olfr1252 UTSW 2 89721776 missense probably benign 0.05
R5076:Olfr1252 UTSW 2 89721401 missense probably damaging 1.00
R5160:Olfr1252 UTSW 2 89721419 missense probably damaging 0.99
R5384:Olfr1252 UTSW 2 89721305 missense possibly damaging 0.94
R5418:Olfr1252 UTSW 2 89721999 missense probably benign
R5763:Olfr1252 UTSW 2 89722028 missense probably benign 0.00
R6997:Olfr1252 UTSW 2 89721925 missense possibly damaging 0.71
R7013:Olfr1252 UTSW 2 89721386 missense probably benign 0.20
R7500:Olfr1252 UTSW 2 89721937 missense possibly damaging 0.90
R7608:Olfr1252 UTSW 2 89721298 missense probably benign 0.42
R7671:Olfr1252 UTSW 2 89721259 missense probably damaging 1.00
R7781:Olfr1252 UTSW 2 89721535 missense probably benign 0.38
R7924:Olfr1252 UTSW 2 89721965 missense probably benign 0.06
R7999:Olfr1252 UTSW 2 89722000 missense probably benign 0.06
X0064:Olfr1252 UTSW 2 89721356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCGATCATAGGCCATCACC -3'
(R):5'- GAGCTGTTACCACTAATAAAATCCTCC -3'

Sequencing Primer
(F):5'- GATCATAGGCCATCACCACCAAAATG -3'
(R):5'- TCCTCCTTGAAGAGTAAATGGGAC -3'
Posted On2019-12-20