Mutagenetix > Incidental Mutation

Incidental Mutation 'R7841:Ptgfrn'

606281

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

045895-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7841 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101060810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 489 (I489N)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: I489N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: I489N

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	C	5: 103,654,940	K16R	possibly damaging	Het
2810408A11Rik	A	G	11: 69,899,286	F210L	probably benign	Het
A930017K11Rik	A	T	17: 25,948,484	Y26*	probably null	Het
Adam6a	G	T	12: 113,545,458	D484Y	probably damaging	Het
AU019823	A	C	9: 50,610,416	S68R	probably damaging	Het
B9d1	A	G	11: 61,506,366	Y29C	possibly damaging	Het
Cald1	T	C	6: 34,745,761	F115L	unknown	Het
Ccnd1	A	T	7: 144,937,981	M107K	probably damaging	Het
Ccnh	G	A	13: 85,189,593	A20T	probably benign	Het
Cep162	T	C	9: 87,244,316	D181G	probably benign	Het
Cep44	AACGC	A	8: 56,540,983		probably null	Het
Ces2b	A	G	8: 104,835,060	D262G	probably benign	Het
Cic	A	G	7: 25,285,767	Y1146C	probably damaging	Het
Cmtm1	G	A	8: 104,309,476	R174C	possibly damaging	Het
Cobl	G	T	11: 12,253,324	P1126H	probably damaging	Het
Col14a1	T	A	15: 55,382,480	M460K	unknown	Het
Cst11	G	A	2: 148,771,307	R33W	possibly damaging	Het
Cyp19a1	A	T	9: 54,171,805	V340E	probably benign	Het
Dbt	A	T	3: 116,546,097	Q378L	possibly damaging	Het
Dchs1	A	G	7: 105,762,973	V1312A	probably benign	Het
Eif3l	T	C	15: 79,089,579	M398T	probably benign	Het
Faxc	A	G	4: 21,958,584	H247R	probably benign	Het
Fbxl17	T	C	17: 63,487,825	R421G	probably damaging	Het
Fbxo3	T	A	2: 104,059,992	D450E	unknown	Het
Fmn1	T	C	2: 113,529,465		probably null	Het
Foxs1	T	A	2: 152,932,987	M49L	possibly damaging	Het
Gucy1a2	A	G	9: 3,634,766	E270G	probably benign	Het
Helz2	T	C	2: 181,232,902	D1933G	probably damaging	Het
Hspa4	G	A	11: 53,267,060	A572V	possibly damaging	Het
Ica1	T	A	6: 8,737,072	D174V	probably damaging	Het
Igfbp6	A	T	15: 102,147,917	Q137L	possibly damaging	Het
Il1r2	T	C	1: 40,105,468	L105P	probably damaging	Het
Iqca	A	T	1: 90,059,615	C72S		Het
Itgbl1	T	C	14: 123,972,233		probably null	Het
Ivl	T	A	3: 92,572,392	Q122L	possibly damaging	Het
Kdsr	T	C	1: 106,743,685	E198G	probably damaging	Het
Lama2	T	C	10: 27,155,533	T1510A	probably benign	Het
Lrrc37a	A	T	11: 103,501,105	Y1165N	probably benign	Het
Mycbp2	A	G	14: 103,146,831		probably null	Het
Myh3	A	G	11: 67,098,692	E1546G	probably damaging	Het
Nacad	A	T	11: 6,601,031	V720E	probably benign	Het
Napa	A	G	7: 16,115,634	D257G	possibly damaging	Het
Nif3l1	T	C	1: 58,447,883	V76A	probably damaging	Het
Nphp4	G	A	4: 152,496,683	S108N	probably benign	Het
Npr1	A	T	3: 90,454,868	L990H	probably damaging	Het
Nup205	A	G	6: 35,247,437	R322G	unknown	Het
Olfr1252	C	A	2: 89,721,965	A49S	probably benign	Het
Olfr668	T	A	7: 104,924,859	I302F	possibly damaging	Het
Olfr735	G	T	14: 50,345,828	Q174K	probably benign	Het
Olfr892-ps1	T	G	9: 38,190,481	M252R	unknown	Het
Olfr897-ps1	T	A	9: 38,309,521	V242E	unknown	Het
Ovch2	G	T	7: 107,794,091	Q192K	probably benign	Het
Pcca	T	A	14: 122,562,972	D91E	probably benign	Het
Pole2	T	C	12: 69,204,258	T444A	probably damaging	Het
Ppip5k1	T	C	2: 121,342,795	K466E	probably benign	Het
Rassf1	A	G	9: 107,561,545	*341W	probably null	Het
Ret	G	A	6: 118,155,360	P1040S	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rsf1	A	AAGGCGACGG	7: 97,579,904		probably null	Het
Slc6a17	A	T	3: 107,476,898	Y377N	possibly damaging	Het
Snrnp200	C	A	2: 127,236,834	D1806E	probably benign	Het
Synj2	G	A	17: 6,044,144	R1215H	unknown	Het
Tbc1d5	TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG	TTGCTGCTG	17: 50,799,922		probably benign	Het
Top2a	A	T	11: 99,022,350	D85E	probably damaging	Het
Tram1l1	A	T	3: 124,321,704	Q171L	probably damaging	Het
Tram1l1	G	T	3: 124,321,705	Q171H	probably damaging	Het
Tspyl4	A	G	10: 34,298,271	H253R	probably damaging	Het
Ttn	T	C	2: 76,832,146	I23V		Het
Ubr5	T	C	15: 37,980,906	N2376D		Het
Ugt2b37	T	C	5: 87,250,630	N316D	probably benign	Het
Usp31	A	T	7: 121,677,312	V334E	probably damaging	Het
Usp31	A	C	7: 121,648,456	S1255A	probably benign	Het
Vmn2r108	A	G	17: 20,470,043		probably null	Het
Vmn2r87	T	A	10: 130,497,226	T52S	probably benign	Het
Vrk2	C	A	11: 26,471,457	L500F	probably damaging	Het
Zan	T	A	5: 137,436,802	I2110F	unknown	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGGCCCAGAATATGTTGAC -3'
(R):5'- ACCTGAACGCTTCTAAGGTC -3'

Sequencing Primer
(F):5'- CCCAGAATATGTTGACAGGCTTG -3'
(R):5'- TAAGGTCCCCGGGTTTTCAGAC -3'

Posted On

2019-12-20