Incidental Mutation 'R7841:Dbt'
ID606283
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Namedihydrolipoamide branched chain transacylase E2
SynonymsD3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location116513070-116549981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116546097 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 378 (Q378L)
Ref Sequence ENSEMBL: ENSMUSP00000000349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000349
AA Change: Q378L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: Q378L

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116539281 missense probably benign
IGL00660:Dbt APN 3 116546295 missense probably damaging 1.00
IGL00839:Dbt APN 3 116546114 missense probably benign 0.21
IGL00840:Dbt APN 3 116546114 missense probably benign 0.21
IGL00841:Dbt APN 3 116546114 missense probably benign 0.21
IGL00852:Dbt APN 3 116546114 missense probably benign 0.21
IGL00861:Dbt APN 3 116546114 missense probably benign 0.21
IGL00955:Dbt APN 3 116546114 missense probably benign 0.21
IGL00956:Dbt APN 3 116546114 missense probably benign 0.21
IGL01475:Dbt APN 3 116520259 missense possibly damaging 0.92
IGL01521:Dbt APN 3 116533383 missense probably benign 0.00
IGL01806:Dbt APN 3 116533305 missense probably damaging 1.00
IGL03288:Dbt APN 3 116548198 makesense probably null
R0025:Dbt UTSW 3 116534783 missense probably benign 0.22
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0190:Dbt UTSW 3 116539087 critical splice acceptor site probably null
R1650:Dbt UTSW 3 116534732 splice site probably null
R1750:Dbt UTSW 3 116546294 missense probably benign 0.18
R2130:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2131:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2133:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2897:Dbt UTSW 3 116523412 missense probably damaging 1.00
R3442:Dbt UTSW 3 116548191 missense probably benign
R4241:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4681:Dbt UTSW 3 116533314 missense probably damaging 1.00
R4724:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4736:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4737:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4738:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4740:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4809:Dbt UTSW 3 116546343 missense probably damaging 1.00
R4823:Dbt UTSW 3 116523387 missense probably damaging 1.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R5148:Dbt UTSW 3 116528244 intron probably benign
R5327:Dbt UTSW 3 116528571 intron probably benign
R5700:Dbt UTSW 3 116520303 missense probably damaging 0.97
R5931:Dbt UTSW 3 116523425 missense possibly damaging 0.80
R6463:Dbt UTSW 3 116539760 missense possibly damaging 0.51
R7924:Dbt UTSW 3 116546097 missense possibly damaging 0.85
R8122:Dbt UTSW 3 116520242 nonsense probably null
RF008:Dbt UTSW 3 116548068 nonsense probably null
RF016:Dbt UTSW 3 116539714 missense probably damaging 1.00
Z1177:Dbt UTSW 3 116546091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAGAGTTTATCTTTTCTTTGC -3'
(R):5'- CACCGATCTGAGAAGAGTGG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- GGAAAATTTAGCTTTCAGGGAATGCC -3'
Posted On2019-12-20