Incidental Mutation 'R7850:Tas2r135'
ID606879
Institutional Source Beutler Lab
Gene Symbol Tas2r135
Ensembl Gene ENSMUSG00000056203
Gene Nametaste receptor, type 2, member 135
Synonymsmt2r38, Tas2r35
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7850 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42405434-42406526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42406138 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 204 (F204I)
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000070178
AA Change: F204I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203
AA Change: F204I

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Mug2 A G 6: 122,075,211 E976G probably damaging Het
Olfr1436 T C 19: 12,298,632 M167V probably benign Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Papln A T 12: 83,780,662 E758V probably damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Pi15 T A 1: 17,602,881 Y101* probably null Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Tas2r135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Tas2r135 APN 6 42406144 missense probably benign 0.00
IGL01395:Tas2r135 APN 6 42405912 nonsense probably null
IGL02479:Tas2r135 APN 6 42405751 nonsense probably null
IGL02526:Tas2r135 APN 6 42406280 missense probably damaging 1.00
IGL02806:Tas2r135 APN 6 42406448 missense probably benign 0.00
IGL02982:Tas2r135 APN 6 42406253 missense probably benign
IGL03057:Tas2r135 APN 6 42401127 unclassified probably benign
R0057:Tas2r135 UTSW 6 42406420 missense probably benign 0.07
R0104:Tas2r135 UTSW 6 42406324 missense possibly damaging 0.79
R1412:Tas2r135 UTSW 6 42405834 missense probably benign 0.00
R4517:Tas2r135 UTSW 6 42406079 missense probably benign
R4629:Tas2r135 UTSW 6 42406226 missense probably benign 0.03
R5788:Tas2r135 UTSW 6 42405597 missense probably damaging 1.00
R6021:Tas2r135 UTSW 6 42406387 missense probably damaging 1.00
R6586:Tas2r135 UTSW 6 42406018 missense probably benign 0.18
R7180:Tas2r135 UTSW 6 42405751 nonsense probably null
R7458:Tas2r135 UTSW 6 42405947 missense possibly damaging 0.95
R7933:Tas2r135 UTSW 6 42406138 missense probably benign
Z1176:Tas2r135 UTSW 6 42406234 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGGCTAAAGTACAGGTTGCC -3'
(R):5'- TACCAGCGTCAGAAAACAGG -3'

Sequencing Primer
(F):5'- AGGTTGCCTGGGTGGGTAC -3'
(R):5'- TACCAGCGTCAGAAAACAGGAGATG -3'
Posted On2019-12-20