Incidental Mutation 'R7877:Glis1'
ID608484
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene NameGLIS family zinc finger 1
SynonymsGliH1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7877 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107434591-107635061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107634703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 776 (D776G)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
Predicted Effect probably damaging
Transcript: ENSMUST00000046005
AA Change: D776G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: D776G

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106738
AA Change: D588G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: D588G

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sntb2 C T 8: 107,011,532 T509I probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107627561 missense probably benign 0.01
IGL02450:Glis1 APN 4 107627529 missense probably benign 0.25
IGL03167:Glis1 APN 4 107435905 missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107615051 missense probably damaging 1.00
IGL03377:Glis1 APN 4 107632281 missense probably damaging 0.98
glenys UTSW 4 107627543 missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107568119 unclassified probably null
R0981:Glis1 UTSW 4 107615042 missense probably damaging 1.00
R1036:Glis1 UTSW 4 107632264 missense probably benign 0.05
R1527:Glis1 UTSW 4 107567926 missense probably damaging 0.96
R1741:Glis1 UTSW 4 107568347 missense probably damaging 1.00
R2937:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107567845 missense probably benign 0.01
R4412:Glis1 UTSW 4 107634718 missense probably damaging 0.99
R4587:Glis1 UTSW 4 107627543 missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107567645 missense probably benign 0.00
R4900:Glis1 UTSW 4 107619564 missense probably damaging 1.00
R5138:Glis1 UTSW 4 107623105 frame shift probably null
R5167:Glis1 UTSW 4 107634694 missense probably damaging 1.00
R5511:Glis1 UTSW 4 107435877 missense probably damaging 0.99
R5568:Glis1 UTSW 4 107619635 missense probably damaging 0.99
R5807:Glis1 UTSW 4 107568082 missense probably benign 0.00
R6006:Glis1 UTSW 4 107567906 missense probably damaging 1.00
R6180:Glis1 UTSW 4 107627513 missense probably benign 0.06
R6219:Glis1 UTSW 4 107631905 missense probably benign 0.27
R6856:Glis1 UTSW 4 107435879 missense probably damaging 0.96
R7278:Glis1 UTSW 4 107435683 start codon destroyed probably null 0.53
R7960:Glis1 UTSW 4 107634703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAGTCTGCCTGTCTTC -3'
(R):5'- CGAGGTCTGTGATTTGAGAACC -3'

Sequencing Primer
(F):5'- TTTGGAGTGCAAGACCCC -3'
(R):5'- ATAGCTCCTGGCAGGCAG -3'
Posted On2019-12-20