Incidental Mutation 'R7884:Etnk2'
ID608926
Institutional Source Beutler Lab
Gene Symbol Etnk2
Ensembl Gene ENSMUSG00000070644
Gene Nameethanolamine kinase 2
Synonyms4933417N20Rik, Eki2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133363572-133380336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133365700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000114272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129213] [ENSMUST00000135222]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129213
AA Change: V24A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644
AA Change: V24A

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135222
AA Change: V127A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644
AA Change: V127A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutation of this gene results in maternal-specific intrauterine growth retardation resulting in reduced litter size and perinatal lethality due to extensive placental thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Etnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1123:Etnk2 UTSW 1 133373272 missense probably benign 0.00
R1551:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R1595:Etnk2 UTSW 1 133373179 missense possibly damaging 0.88
R1728:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1728:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1728:Etnk2 UTSW 1 133365816 nonsense probably null
R1728:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1728:Etnk2 UTSW 1 133376915 missense probably benign
R1729:Etnk2 UTSW 1 133363923 missense probably benign
R1729:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1729:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1729:Etnk2 UTSW 1 133365816 nonsense probably null
R1729:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1729:Etnk2 UTSW 1 133376915 missense probably benign
R1730:Etnk2 UTSW 1 133363923 missense probably benign
R1730:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1730:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1730:Etnk2 UTSW 1 133365816 nonsense probably null
R1730:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1730:Etnk2 UTSW 1 133376915 missense probably benign
R1739:Etnk2 UTSW 1 133363923 missense probably benign
R1739:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1739:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1739:Etnk2 UTSW 1 133365816 nonsense probably null
R1739:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1739:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1762:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1762:Etnk2 UTSW 1 133365816 nonsense probably null
R1762:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1762:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1783:Etnk2 UTSW 1 133363923 missense probably benign
R1783:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1783:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1783:Etnk2 UTSW 1 133365816 nonsense probably null
R1783:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1783:Etnk2 UTSW 1 133376915 missense probably benign
R1783:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1784:Etnk2 UTSW 1 133363890 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1784:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1784:Etnk2 UTSW 1 133365816 nonsense probably null
R1784:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133376915 missense probably benign
R1784:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1785:Etnk2 UTSW 1 133363923 missense probably benign
R1785:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1785:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1785:Etnk2 UTSW 1 133365816 nonsense probably null
R1785:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1785:Etnk2 UTSW 1 133376915 missense probably benign
R2089:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R5141:Etnk2 UTSW 1 133368862 missense probably benign 0.01
R5418:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R5586:Etnk2 UTSW 1 133379305 splice site probably null
R5922:Etnk2 UTSW 1 133363885 splice site probably null
R8290:Etnk2 UTSW 1 133379389 makesense probably null
X0025:Etnk2 UTSW 1 133373239 missense probably damaging 1.00
X0026:Etnk2 UTSW 1 133365670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTGAAGCTCTGGGAAGAG -3'
(R):5'- TTGTTCACAGCCAAGACCATC -3'

Sequencing Primer
(F):5'- AGAGCGGAGGACCATGCC -3'
(R):5'- CACAGCCTCTGAGAAAATGATG -3'
Posted On2019-12-20