Incidental Mutation 'R7884:Zkscan5'
ID608936
Institutional Source Beutler Lab
Gene Symbol Zkscan5
Ensembl Gene ENSMUSG00000055991
Gene Namezinc finger with KRAB and SCAN domains 5
SynonymsZfp95, hKraba1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145204562-145221750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145220866 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 726 (H726P)
Ref Sequence ENSEMBL: ENSMUSP00000082814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031601] [ENSMUST00000085671] [ENSMUST00000161896]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031601
AA Change: H653P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031601
Gene: ENSMUSG00000055991
AA Change: H653P

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 1.45e-2 SMART
ZnF_C2H2 352 374 1.28e-3 SMART
ZnF_C2H2 467 489 1.82e-3 SMART
ZnF_C2H2 495 517 3.63e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 9.73e-4 SMART
ZnF_C2H2 579 601 1.08e-1 SMART
ZnF_C2H2 635 657 1.12e-3 SMART
ZnF_C2H2 691 713 5.14e-3 SMART
ZnF_C2H2 719 741 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085671
AA Change: H726P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082814
Gene: ENSMUSG00000055991
AA Change: H726P

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
KRAB 216 276 5.35e-3 SMART
ZnF_C2H2 341 363 3.58e-2 SMART
ZnF_C2H2 369 391 9.73e-4 SMART
ZnF_C2H2 397 419 1.45e-2 SMART
ZnF_C2H2 425 447 1.28e-3 SMART
ZnF_C2H2 540 562 1.82e-3 SMART
ZnF_C2H2 568 590 3.63e-3 SMART
ZnF_C2H2 596 618 7.78e-3 SMART
ZnF_C2H2 624 646 9.73e-4 SMART
ZnF_C2H2 652 674 1.08e-1 SMART
ZnF_C2H2 708 730 1.12e-3 SMART
ZnF_C2H2 764 786 5.14e-3 SMART
ZnF_C2H2 792 814 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161881
SMART Domains Protein: ENSMUSP00000124544
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
KRAB 59 118 2.71e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161896
SMART Domains Protein: ENSMUSP00000124838
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 1.59e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162168
Meta Mutation Damage Score 0.9422 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain and may be involved in transcriptional regulation. A similar protein in mouse is differentially expressed in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Other mutations in Zkscan5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Zkscan5 APN 5 145218650 missense probably damaging 0.99
R0401:Zkscan5 UTSW 5 145212575 missense probably damaging 0.99
R0458:Zkscan5 UTSW 5 145205471 missense probably damaging 0.97
R1456:Zkscan5 UTSW 5 145220988 missense probably benign 0.03
R1801:Zkscan5 UTSW 5 145220205 missense probably damaging 1.00
R2269:Zkscan5 UTSW 5 145205467 missense probably damaging 1.00
R2426:Zkscan5 UTSW 5 145220940 missense probably benign
R3085:Zkscan5 UTSW 5 145221079 missense probably damaging 1.00
R3153:Zkscan5 UTSW 5 145212627 missense probably benign
R3725:Zkscan5 UTSW 5 145220913 missense probably damaging 0.98
R4479:Zkscan5 UTSW 5 145211174 intron probably benign
R4647:Zkscan5 UTSW 5 145218830 missense possibly damaging 0.71
R5292:Zkscan5 UTSW 5 145218641 missense probably damaging 1.00
R5872:Zkscan5 UTSW 5 145220088 missense probably benign
R5873:Zkscan5 UTSW 5 145220394 missense possibly damaging 0.71
R5916:Zkscan5 UTSW 5 145205302 missense possibly damaging 0.90
R6692:Zkscan5 UTSW 5 145221084 splice site probably null
R7092:Zkscan5 UTSW 5 145220089 missense probably benign
R7114:Zkscan5 UTSW 5 145211178 intron probably benign
R7403:Zkscan5 UTSW 5 145218593 missense probably benign 0.31
R7719:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7741:Zkscan5 UTSW 5 145221037 missense possibly damaging 0.51
R7751:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7829:Zkscan5 UTSW 5 145218703 nonsense probably null
R7874:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7875:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7876:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7879:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7899:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7902:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCAAGTGCTCCATGTG -3'
(R):5'- AGAGGCTACAGCTCCAACTG -3'

Sequencing Primer
(F):5'- CTCCATGTGGGCCAGAAGAG -3'
(R):5'- CTTACACTGGAGGGGCTTCTC -3'
Posted On2019-12-20