Incidental Mutation 'R7884:Gnb3'
ID608937
Institutional Source Beutler Lab
Gene Symbol Gnb3
Ensembl Gene ENSMUSG00000023439
Gene Nameguanine nucleotide binding protein (G protein), beta 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124834240-124840275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124837092 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 178 (T178A)
Ref Sequence ENSEMBL: ENSMUSP00000024206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000131847] [ENSMUST00000135127] [ENSMUST00000150120] [ENSMUST00000151674]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024206
AA Change: T178A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439
AA Change: T178A

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
Predicted Effect probably benign
Transcript: ENSMUST00000131847
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150120
Predicted Effect probably benign
Transcript: ENSMUST00000151674
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal light ON response and synaptic maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Gnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gnb3 APN 6 124837255 missense probably damaging 0.98
IGL01707:Gnb3 APN 6 124839689 missense possibly damaging 0.56
IGL02412:Gnb3 APN 6 124837462 missense probably benign 0.23
IGL02606:Gnb3 APN 6 124837415 missense probably benign 0.01
IGL02627:Gnb3 APN 6 124834715 missense probably damaging 0.98
IGL02669:Gnb3 APN 6 124837725 missense probably benign 0.17
R0006:Gnb3 UTSW 6 124835804 unclassified probably benign
R0026:Gnb3 UTSW 6 124837417 missense probably benign 0.00
R0445:Gnb3 UTSW 6 124837255 missense possibly damaging 0.92
R0538:Gnb3 UTSW 6 124835696 nonsense probably null
R1801:Gnb3 UTSW 6 124835636 missense probably benign 0.13
R4074:Gnb3 UTSW 6 124836979 missense probably benign
R6715:Gnb3 UTSW 6 124837728 missense possibly damaging 0.94
R7146:Gnb3 UTSW 6 124836924 critical splice donor site probably null
R7689:Gnb3 UTSW 6 124837220 missense possibly damaging 0.82
R8198:Gnb3 UTSW 6 124837037 missense probably benign 0.10
X0017:Gnb3 UTSW 6 124837068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGACTCACACAGATGGC -3'
(R):5'- AGGGTGCTGTCCTTCTAACC -3'

Sequencing Primer
(F):5'- CACAGATGGCATTGATGTCTGACTC -3'
(R):5'- GTTGCCGCTTCCTGGATGAC -3'
Posted On2019-12-20