Incidental Mutation 'R7898:Zzef1'
ID 609832
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms C130099L13Rik, 8430405D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7898 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72796226-72927120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72796547 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 84 (L84R)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000079681] [ENSMUST00000156294] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: L84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: L84R

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079681
SMART Domains Protein: ENSMUSP00000078623
Gene: ENSMUSG00000057778

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Cyt-b5 38 134 5.75e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156294
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: L84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: L84R

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: L84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4931409K22Rik T C 5: 24,553,645 E117G probably damaging Het
Acaca T C 11: 84,364,449 probably null Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
BC017158 C A 7: 128,298,005 A27S probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Eno2 C T 6: 124,767,262 probably null Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gbp11 T C 5: 105,324,932 N542S probably benign Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Isl2 C A 9: 55,542,439 S97R probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl23 T C 11: 116,845,853 probably benign Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Smchd1 T C 17: 71,377,818 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Spata5 T G 3: 37,420,471 M44R probably benign Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tnpo3 T C 6: 29,565,224 I577V probably benign Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72863989 missense probably benign 0.00
R8885:Zzef1 UTSW 11 72796576 missense probably benign 0.00
R8972:Zzef1 UTSW 11 72900673 missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72875177 missense probably benign 0.00
R9053:Zzef1 UTSW 11 72922476 missense probably benign
R9108:Zzef1 UTSW 11 72899778 missense probably benign 0.11
R9121:Zzef1 UTSW 11 72866120 nonsense probably null
R9370:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72864827 missense possibly damaging 0.86
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAAGATTGGGCTGCCGAC -3'
(R):5'- TCTAAGAACCCGAGGACCCTATG -3'

Sequencing Primer
(F):5'- ATTGGGCTGCCGACTCTGG -3'
(R):5'- AGGACCCTATGGCTTCCTG -3'
Posted On 2019-12-20