Mutagenetix > Incidental Mutation

Incidental Mutation 'R1646:Zzef1'

173896

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

039682-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1646 (G1)

Quality Score

206

Status

Validated

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 72864036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000069395] [ENSMUST00000069395] [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000172220] [ENSMUST00000172220] [ENSMUST00000172220] [ENSMUST00000207107] [ENSMUST00000207107] [ENSMUST00000207107] [ENSMUST00000207107]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069395

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000069395

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000069395

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000069395

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172220

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172220

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172220

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172220

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000207107

Predicted Effect

probably null
Transcript: ENSMUST00000207107

Predicted Effect

probably null
Transcript: ENSMUST00000207107

Predicted Effect

probably null
Transcript: ENSMUST00000207107

Meta Mutation Damage Score

0.9500

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.8%

Validation Efficiency

96% (69/72)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,462,990	S751T	probably damaging	Het
Akna	T	G	4: 63,383,892	I581L	probably benign	Het
Cacnb4	A	G	2: 52,474,900	I117T	possibly damaging	Het
Capn1	A	T	19: 5,997,730	F434L	probably benign	Het
Cbs	T	C	17: 31,613,195	T547A	probably benign	Het
Col6a5	A	T	9: 105,862,749	L2557*	probably null	Het
D17Wsu92e	A	G	17: 27,793,960	S88P	probably damaging	Het
D1Ertd622e	A	T	1: 97,645,806	I178N	probably damaging	Het
Dach1	A	G	14: 98,169,114	S66P	unknown	Het
Ddx31	T	C	2: 28,892,520	V625A	probably benign	Het
Dmxl1	T	G	18: 49,962,261	V2969G	probably damaging	Het
Eapp	T	A	12: 54,685,960	K122*	probably null	Het
Epb41l5	G	T	1: 119,550,022		probably benign	Het
Fat1	T	C	8: 45,018,042	S1628P	probably damaging	Het
Fgfr2	T	A	7: 130,242,644	E37V	probably damaging	Het
Fgfr4	A	T	13: 55,165,964	N529Y	probably damaging	Het
Fsip2	A	T	2: 82,978,517	T1727S	probably benign	Het
Gak	A	T	5: 108,602,854	S397T	probably damaging	Het
Gm6040	T	A	8: 20,917,097	I36F	possibly damaging	Het
Grhl1	A	G	12: 24,611,861	D513G	possibly damaging	Het
Gstt1	T	A	10: 75,784,106	D219V	possibly damaging	Het
Hcfc2	T	G	10: 82,701,027	V91G	probably damaging	Het
Hells	A	T	19: 38,967,783	I808L	probably benign	Het
Icmt	T	A	4: 152,299,715	V110E	possibly damaging	Het
Iqca	C	T	1: 90,140,038	V164M	probably damaging	Het
Klri1	G	A	6: 129,703,336	P119S	probably benign	Het
Krt71	C	A	15: 101,738,764		probably null	Het
Lpin1	A	G	12: 16,573,658		probably null	Het
Metap2	T	C	10: 93,870,197	H241R	probably damaging	Het
Myh15	A	G	16: 49,195,568	Y1869C	probably damaging	Het
Myo1h	G	A	5: 114,317,632	G59E	possibly damaging	Het
Ncam2	T	G	16: 81,465,706		probably benign	Het
Npat	T	C	9: 53,555,134	V241A	probably benign	Het
Npbwr1	C	A	1: 5,917,254	V14L	probably benign	Het
Nup37	T	A	10: 88,178,234	V323E	possibly damaging	Het
Olfr1036	A	G	2: 86,075,616	N292S	probably damaging	Het
Olfr1351	C	A	10: 79,017,506	Y61*	probably null	Het
Olfr483	C	T	7: 108,103,591	T94I	probably benign	Het
Olfr743	A	T	14: 50,533,583	Q57L	probably benign	Het
Pdlim4	A	T	11: 54,056,254	L132Q	possibly damaging	Het
Ptcd3	T	C	6: 71,898,395	D201G	probably benign	Het
Ptk7	A	T	17: 46,586,297	F370I	probably benign	Het
Pus7l	T	C	15: 94,533,636	N371D	probably benign	Het
Pzp	G	A	6: 128,503,555	A589V	probably benign	Het
Rasef	T	A	4: 73,734,549	R572W	probably damaging	Het
Reep5	T	C	18: 34,349,659	T166A	probably benign	Het
Rhov	A	G	2: 119,271,020	V35A	probably damaging	Het
Ripk4	C	T	16: 97,743,897	G517R	probably damaging	Het
Rnasel	A	G	1: 153,755,054	T439A	probably damaging	Het
Slamf9	A	G	1: 172,477,340	T174A	probably benign	Het
Slc12a9	A	G	5: 137,323,149	L414P	probably damaging	Het
Slf1	G	A	13: 77,066,648	R640*	probably null	Het
Slfn8	G	T	11: 83,016,886	P277Q	probably damaging	Het
Stpg2	T	A	3: 139,419,702		probably benign	Het
Tm9sf3	A	C	19: 41,223,179	N408K	possibly damaging	Het
Trio	A	G	15: 27,758,347	V2049A	possibly damaging	Het
Ttn	A	T	2: 76,814,733	I11180N	probably damaging	Het
Ush2a	T	C	1: 188,415,821	C982R	probably damaging	Het
Usp36	C	T	11: 118,273,566	V207M	probably damaging	Het
Uvrag	T	C	7: 99,118,224	T67A	probably damaging	Het
Vasp	G	A	7: 19,260,978		probably benign	Het
Vmn2r115	T	C	17: 23,359,539	F662S	probably damaging	Het
Vmn2r54	A	T	7: 12,632,507	C167S	probably damaging	Het
Vmn2r71	C	A	7: 85,621,268	N547K	probably damaging	Het
Wasf2	A	G	4: 133,176,591	I37V	probably benign	Het
Wwc2	T	C	8: 47,842,902	E1111G	unknown	Het
Zfp317	A	G	9: 19,647,312	Y274C	probably damaging	Het
Zhx3	T	C	2: 160,781,275	Y324C	probably damaging	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
Dreidel	UTSW	11	72908469	nonsense	probably null
Hanukkah	UTSW	11	72893332	missense	probably benign	0.00
Mezuzah	UTSW	11	72848733	nonsense	probably null
BB005:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
BB015:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0136:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2134:Zzef1	UTSW	11	72880624	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	splice site	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R6987:Zzef1	UTSW	11	72855514	missense	possibly damaging	0.89
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7284:Zzef1	UTSW	11	72886690	missense	probably damaging	0.99
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7928:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
R8021:Zzef1	UTSW	11	72823416	missense	probably damaging	0.99
R8145:Zzef1	UTSW	11	72908469	nonsense	probably null
R8255:Zzef1	UTSW	11	72875129	missense	probably benign	0.00
R8303:Zzef1	UTSW	11	72917189	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72872604	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72886746	missense	probably damaging	0.97
R8498:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R8547:Zzef1	UTSW	11	72844441	missense	probably damaging	1.00
R8874:Zzef1	UTSW	11	72863989	missense	probably benign	0.00
R8885:Zzef1	UTSW	11	72796576	missense	probably benign	0.00
R8972:Zzef1	UTSW	11	72900673	missense	probably damaging	1.00
R8979:Zzef1	UTSW	11	72875177	missense	probably benign	0.00
R9053:Zzef1	UTSW	11	72922476	missense	probably benign
R9108:Zzef1	UTSW	11	72899778	missense	probably benign	0.11
R9121:Zzef1	UTSW	11	72866120	nonsense	probably null
R9253:Zzef1	UTSW	11	72848637	splice site	probably benign
R9370:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R9408:Zzef1	UTSW	11	72864827	missense	possibly damaging	0.86
R9467:Zzef1	UTSW	11	72916425	missense	probably damaging	1.00
R9468:Zzef1	UTSW	11	72923183	critical splice donor site	probably null
R9563:Zzef1	UTSW	11	72874906	missense	probably damaging	1.00
R9647:Zzef1	UTSW	11	72869825	missense	probably benign	0.01
R9667:Zzef1	UTSW	11	72867960	missense	probably benign
R9742:Zzef1	UTSW	11	72858353	missense	probably benign
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29
Z1176:Zzef1	UTSW	11	72796528	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72796312	missense	possibly damaging	0.91
Z1177:Zzef1	UTSW	11	72826178	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72900631	critical splice acceptor site	probably null
Z1177:Zzef1	UTSW	11	72915320	missense	probably damaging	1.00
Z1186:Zzef1	UTSW	11	72889182	missense	probably benign
Z1187:Zzef1	UTSW	11	72889182	missense	probably benign
Z1188:Zzef1	UTSW	11	72889182	missense	probably benign
Z1189:Zzef1	UTSW	11	72889182	missense	probably benign
Z1190:Zzef1	UTSW	11	72889182	missense	probably benign
Z1191:Zzef1	UTSW	11	72889182	missense	probably benign
Z1192:Zzef1	UTSW	11	72889182	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGGCCTATGGAGGAAAACTGTGTG -3'
(R):5'- GGGGTTCTGCATTCGACCAGATTG -3'

Sequencing Primer
(F):5'- CAGTCACTCTGGCAGAGATG -3'
(R):5'- acatgcctgtaatccagcac -3'

Posted On

2014-04-24