Incidental Mutation 'R8009:Pcsk1'
ID 616821
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Name proprotein convertase subtilisin/kexin type 1
Synonyms PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 75089826-75134861 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75126839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 516 (S516P)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
AlphaFold P63239
PDB Structure Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000022075
AA Change: S516P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: S516P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222727
Meta Mutation Damage Score 0.1207 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Baz1a A T 12: 54,895,031 Y1466* probably null Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Esyt1 T C 10: 128,511,485 E1057G probably benign Het
Fsip2 A G 2: 82,988,449 E4842G possibly damaging Het
Gadd45b G A 10: 80,931,150 V90I probably benign Het
Gfi1 T A 5: 107,723,801 H79L probably damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Itsn2 G A 12: 4,664,553 A950T probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Lrch3 A T 16: 33,005,713 D720V possibly damaging Het
Lrrk1 T C 7: 66,265,474 D1622G possibly damaging Het
Meioc G C 11: 102,676,743 A788P probably damaging Het
Mmp1a A T 9: 7,467,235 T271S possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1089 A G 2: 86,733,504 L36P probably damaging Het
Olfr126 A T 17: 37,850,802 D70V probably damaging Het
Phactr3 A C 2: 178,332,944 R523S probably damaging Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Prkcg A G 7: 3,314,192 D294G probably benign Het
Psg28 T A 7: 18,422,997 I438L probably damaging Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Rps6ka5 T C 12: 100,577,789 E350G probably damaging Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgce T C 6: 4,691,636 D313G probably damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Stxbp5 A G 10: 9,816,302 V366A probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tlr3 G A 8: 45,400,782 T167M not run Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tmprss15 C T 16: 79,090,863 V19M probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Uso1 A T 5: 92,166,580 E115D probably benign Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
spareribs UTSW 13 75115255 missense possibly damaging 0.88
swivel UTSW 13 75125984 missense probably damaging 1.00
Tweeze UTSW 13 75126839 missense probably benign 0.00
PIT4453001:Pcsk1 UTSW 13 75112650 missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75132225 missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2252:Pcsk1 UTSW 13 75126726 missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75097907 missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75115255 missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
R7357:Pcsk1 UTSW 13 75125960 missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75110883 missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75110865 missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75132210 missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75132158 missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75132092 missense probably benign
R7945:Pcsk1 UTSW 13 75132092 missense probably benign
R7961:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75099293 missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75090091 nonsense probably null
R8489:Pcsk1 UTSW 13 75126002 missense probably damaging 1.00
R9310:Pcsk1 UTSW 13 75090072 missense probably benign
R9404:Pcsk1 UTSW 13 75132223 missense probably benign 0.11
R9544:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9588:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9706:Pcsk1 UTSW 13 75099354 critical splice donor site probably null
Z1176:Pcsk1 UTSW 13 75098042 missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75125864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACAAACAAACCAATGGATGG -3'
(R):5'- ATTGTCACATAAGAGAAGCGAATGC -3'

Sequencing Primer
(F):5'- ATGGATGGCAGGAGAGATACTTTTTC -3'
(R):5'- GCGAATGCTCAGTCTTTTATCTTG -3'
Posted On 2020-01-23