Incidental Mutation 'R7639:Brip1'
ID628303
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7639 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86152822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect probably null
Transcript: ENSMUST00000044423
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,670,103 M381L probably benign Het
Abl1 T A 2: 31,779,161 L184Q probably damaging Het
Atp8b1 A G 18: 64,564,543 V410A possibly damaging Het
Bhmt2 C T 13: 93,663,314 G205R probably damaging Het
Bicd1 A G 6: 149,513,004 D405G possibly damaging Het
Ccdc180 A T 4: 45,928,043 I1193F possibly damaging Het
Cdc14b A G 13: 64,205,329 C478R possibly damaging Het
Celsr1 C T 15: 85,929,872 E1950K probably benign Het
Cnot7 A G 8: 40,507,453 probably null Het
Defa34 A T 8: 21,665,867 K24I probably benign Het
Dsg4 G T 18: 20,449,712 D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 V1258F probably damaging Het
Erbb3 A G 10: 128,569,847 S1181P probably damaging Het
Evl A G 12: 108,686,103 D366G probably damaging Het
Fam234b A T 6: 135,225,800 probably null Het
Fanca A G 8: 123,291,395 probably null Het
Fbxo46 T A 7: 19,136,635 V393E probably damaging Het
Gkap1 T G 13: 58,263,970 K63T probably damaging Het
Hfm1 T A 5: 106,889,925 D742V probably benign Het
Hfm1 A G 5: 106,898,475 V515A possibly damaging Het
Itga10 G A 3: 96,649,582 V207I probably benign Het
Lipi T A 16: 75,560,855 Y274F probably benign Het
Mettl8 A T 2: 70,982,182 S36R probably benign Het
Miip A T 4: 147,862,564 M244K probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nav1 T C 1: 135,471,122 N574S probably benign Het
Nlrc4 C T 17: 74,447,957 probably null Het
Oas2 C T 5: 120,745,686 W244* probably null Het
Oat A T 7: 132,566,801 I163N probably damaging Het
Olfr57 A G 10: 79,035,372 D192G probably damaging Het
Otop3 T C 11: 115,344,361 M273T possibly damaging Het
Poln A C 5: 34,133,151 V60G possibly damaging Het
Ppp1r13b G T 12: 111,833,615 A699E probably damaging Het
Rims1 A T 1: 22,805,669 M19K probably benign Het
Rnf145 T C 11: 44,531,357 L89P probably damaging Het
Rock1 A G 18: 10,140,244 S116P probably damaging Het
Rtn3 C T 19: 7,457,991 C212Y probably benign Het
Smcp G A 3: 92,584,490 P17S unknown Het
Syne2 A C 12: 75,934,499 E1525A probably damaging Het
Tpra1 A G 6: 88,910,176 D172G probably benign Het
Traf2 TAGA TA 2: 25,537,088 probably null Het
Trpa1 T C 1: 14,886,913 T760A probably benign Het
Unc13c T A 9: 73,933,168 S134C probably damaging Het
Zfp729b C T 13: 67,591,852 V765I probably benign Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGCATCCTCTATCAGTTCTCGAG -3'
(R):5'- TCATCCTTTCAGAAATGTTATGGC -3'

Sequencing Primer
(F):5'- AGCTGTATAGTAGGGACAAGCTTTC -3'
(R):5'- TGTACTTCCAGCTCCACGAGATAG -3'
Posted On2020-02-27