Incidental Mutation 'R5525:Brip1'
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 043083-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86110447 bp
Amino Acid Change Glutamic Acid to Glycine at position 721 (E721G)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044423
AA Change: E721G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: E721G

DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
blip UTSW 11 86074298 missense possibly damaging 0.85
radar UTSW 11 86152669 nonsense probably null
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7639:Brip1 UTSW 11 86152822 splice site probably null
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
R8125:Brip1 UTSW 11 86186991 missense possibly damaging 0.73
R8236:Brip1 UTSW 11 86139112 missense probably damaging 0.98
R8509:Brip1 UTSW 11 86197948 nonsense probably null
R8815:Brip1 UTSW 11 86189772 missense probably benign 0.17
R8877:Brip1 UTSW 11 86152706 missense possibly damaging 0.93
R8938:Brip1 UTSW 11 86148401 missense possibly damaging 0.53
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-10-05