Incidental Mutation 'R4384:Brip1'
ID326123
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 042002-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86148429 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 426 (D426E)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044423
AA Change: D426E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: D426E

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCGAGTCATCTCTTCAGCATC -3'
(R):5'- GCACAAGCAATATTGGCCTATATTG -3'

Sequencing Primer
(F):5'- ACATGTCTTTAAAGCCGGGC -3'
(R):5'- CTGAAAGGACAAGTTGTCAT -3'
Posted On2015-07-06