Mutagenetix > Incidental Mutations

Incidental Mutation 'R4384:Brip1'

326123

Institutional Source

Beutler Lab

Gene Symbol

Brip1

Ensembl Gene

ENSMUSG00000034329

Gene Name

BRCA1 interacting protein C-terminal helicase 1

Synonyms

8030460J03Rik, 3110009N10Rik, BACH1

MMRRC Submission

042002-MU

Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86058138-86201193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86148429 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 426 (D426E)

Ref Sequence

ENSEMBL: ENSMUSP00000043108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044423]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044423
AA Change: D426E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: D426E

Domain	Start	End	E-Value	Type
DEXDc	17	520	1.4e-3	SMART
HELICc	701	854	8.2e-41	SMART

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,568	V27E	possibly damaging	Het
Adam23	T	C	1: 63,566,628	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,930,157	C132*	probably null	Het
Boc	A	T	16: 44,491,182	L726H	probably damaging	Het
Cadps2	T	A	6: 23,412,988	Q654L	probably benign	Het
Calr3	T	A	8: 72,428,164	D120V	probably damaging	Het
Cntnap3	A	G	13: 64,748,460	Y1067H	probably damaging	Het
Csnk1g1	T	C	9: 66,019,908	V119A	probably damaging	Het
Ddias	G	A	7: 92,858,223	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,811,450	Y763C	probably damaging	Het
Dscam	T	A	16: 96,709,216	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,919,393		probably benign	Het
E2f8	G	A	7: 48,867,099	T844I	possibly damaging	Het
Eps8	T	A	6: 137,499,592	H603L	probably benign	Het
Esrrg	G	A	1: 188,043,711	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,594,563	R467*	probably null	Het
Gad2	G	A	2: 22,685,410	V509I	probably benign	Het
Gpat4	A	G	8: 23,174,586	I446T	probably benign	Het
Klhl12	T	G	1: 134,487,654	D435E	probably damaging	Het
Luc7l	T	C	17: 26,279,962		probably benign	Het
March2	C	A	17: 33,696,193	M142I	probably benign	Het
Marf1	T	A	16: 14,142,641	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,696,439	D114G	possibly damaging	Het
Med1	G	A	11: 98,152,862		probably benign	Het
Meikin	C	T	11: 54,417,787	Q404*	probably null	Het
Myh9	A	T	15: 77,791,712		probably benign	Het
Mylip	T	C	13: 45,389,958	M1T	probably null	Het
Ncapg2	T	C	12: 116,439,877		probably null	Het
Nmd3	T	C	3: 69,724,398		probably benign	Het
Nwd2	T	A	5: 63,806,571	L1166H	probably damaging	Het
Olfr341	A	G	2: 36,479,998	L44P	probably damaging	Het
Olfr912	T	C	9: 38,582,053	Y259H	probably damaging	Het
Rubcn	A	G	16: 32,856,902	I71T	probably damaging	Het
Rwdd3	T	C	3: 121,158,757		probably benign	Het
Ryr2	T	C	13: 11,605,233	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,298,257	Q273R	probably benign	Het
Sdha	A	T	13: 74,326,985	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,702,883	L771P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,247,727	E624G	possibly damaging	Het
Tada3	G	T	6: 113,370,379	R117S	probably damaging	Het
Tm9sf3	T	C	19: 41,247,933	M130V	probably damaging	Het
Trpc1	C	A	9: 95,732,108	M34I	probably benign	Het
Trpc4ap	A	G	2: 155,640,507	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,917,725	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,428,682	S80P	probably benign	Het
Usp54	A	T	14: 20,550,085		probably null	Het
Vmn2r27	A	G	6: 124,224,156	Y281H	probably benign	Het
Vwf	T	A	6: 125,655,116	I37N	unknown	Het
Zfp329	G	A	7: 12,811,657		probably benign	Het
Zfp616	G	T	11: 74,083,179	L91F	possibly damaging	Het

Other mutations in Brip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Brip1	APN	11	86148401	missense	possibly damaging	0.53
IGL01098:Brip1	APN	11	86108862	missense	possibly damaging	0.71
IGL01503:Brip1	APN	11	86061877	missense	probably benign	0.33
IGL01602:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01605:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01940:Brip1	APN	11	86064966	missense	probably benign	0.00
IGL02019:Brip1	APN	11	86197949	missense	possibly damaging	0.73
IGL02212:Brip1	APN	11	86139015	missense	possibly damaging	0.86
IGL02456:Brip1	APN	11	86065099	missense	possibly damaging	0.71
IGL02727:Brip1	APN	11	86152736	missense	probably benign	0.02
IGL02983:Brip1	APN	11	86139124	missense	probably benign	0.03
IGL03022:Brip1	APN	11	86077950	missense	probably damaging	0.98
IGL03116:Brip1	APN	11	86064909	nonsense	probably null
IGL03143:Brip1	APN	11	86061827	missense	possibly damaging	0.53
blip	UTSW	11	86074298	missense	possibly damaging	0.85
radar	UTSW	11	86152669	nonsense	probably null
P0018:Brip1	UTSW	11	86108868	missense	possibly damaging	0.51
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0446:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R0498:Brip1	UTSW	11	86197919	missense	possibly damaging	0.96
R0599:Brip1	UTSW	11	86152737	missense	probably benign
R0653:Brip1	UTSW	11	86152658	missense	possibly damaging	0.85
R0661:Brip1	UTSW	11	86110363	missense	possibly damaging	0.86
R0671:Brip1	UTSW	11	86152667	missense	possibly damaging	0.93
R0718:Brip1	UTSW	11	86143305	missense	possibly damaging	0.96
R0750:Brip1	UTSW	11	86061499	missense	possibly damaging	0.53
R0834:Brip1	UTSW	11	86192827	missense	probably benign
R1128:Brip1	UTSW	11	86064937	missense	possibly damaging	0.86
R1726:Brip1	UTSW	11	86064914	missense	probably benign	0.17
R1813:Brip1	UTSW	11	86187080	missense	possibly damaging	0.53
R1885:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R1886:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R2093:Brip1	UTSW	11	86139145	missense	possibly damaging	0.53
R2206:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R2207:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R3404:Brip1	UTSW	11	86143263	missense	possibly damaging	0.96
R3421:Brip1	UTSW	11	86152669	nonsense	probably null
R3876:Brip1	UTSW	11	86152790	missense	probably damaging	0.98
R4018:Brip1	UTSW	11	86138851	missense	possibly damaging	0.86
R4092:Brip1	UTSW	11	86148521	missense	possibly damaging	0.92
R4394:Brip1	UTSW	11	86074298	missense	possibly damaging	0.85
R4518:Brip1	UTSW	11	86077878	missense	possibly damaging	0.92
R4522:Brip1	UTSW	11	86189801	missense	possibly damaging	0.49
R4840:Brip1	UTSW	11	86146183	missense	possibly damaging	0.86
R5025:Brip1	UTSW	11	86064980	missense	probably benign	0.04
R5176:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R5213:Brip1	UTSW	11	86143321	missense	possibly damaging	0.73
R5470:Brip1	UTSW	11	86148542	missense	possibly damaging	0.71
R5525:Brip1	UTSW	11	86110447	missense	possibly damaging	0.85
R6057:Brip1	UTSW	11	86065039	missense	possibly damaging	0.73
R6819:Brip1	UTSW	11	86110441	missense	possibly damaging	0.51
R6908:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R6920:Brip1	UTSW	11	86148536	nonsense	probably null
R7053:Brip1	UTSW	11	86192965	missense	possibly damaging	0.53
R7235:Brip1	UTSW	11	86138875	missense	possibly damaging	0.53
R7253:Brip1	UTSW	11	86143278	missense	possibly damaging	0.96
R7347:Brip1	UTSW	11	86139103	missense	probably benign	0.34
R7476:Brip1	UTSW	11	86157808	missense	probably benign	0.33
R7580:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R7639:Brip1	UTSW	11	86152822	splice site	probably null
R7771:Brip1	UTSW	11	86062024	missense	probably benign	0.02
R8125:Brip1	UTSW	11	86186991	missense	possibly damaging	0.73
R8236:Brip1	UTSW	11	86139112	missense	probably damaging	0.98
R8509:Brip1	UTSW	11	86197948	nonsense	probably null
X0060:Brip1	UTSW	11	86152619	missense	possibly damaging	0.71
X0062:Brip1	UTSW	11	86143356	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- ACCGAGTCATCTCTTCAGCATC -3'
(R):5'- GCACAAGCAATATTGGCCTATATTG -3'

Sequencing Primer
(F):5'- ACATGTCTTTAAAGCCGGGC -3'
(R):5'- CTGAAAGGACAAGTTGTCAT -3'

Posted On

2015-07-06