Incidental Mutation 'R8169:Myh3'
ID633986
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R8169 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67089030 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 598 (N598K)
Ref Sequence ENSEMBL: ENSMUSP00000007301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably benign
Transcript: ENSMUST00000007301
AA Change: N598K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: N598K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108689
AA Change: N598K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: N598K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165221
AA Change: N598K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: N598K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik C A 5: 139,364,057 G79V probably damaging Het
4930562C15Rik T A 16: 4,866,218 Y226N probably benign Het
6430573F11Rik A T 8: 36,511,703 K153N probably damaging Het
Bach1 G A 16: 87,722,502 C560Y possibly damaging Het
BC049730 T A 7: 24,712,575 M60K probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Casq2 G T 3: 102,110,312 A103S possibly damaging Het
Cfap100 A G 6: 90,417,674 F57S Het
Clca2 A T 3: 145,077,892 L654Q probably damaging Het
Cntnap5c T A 17: 58,104,770 probably null Het
Crtc2 G C 3: 90,263,576 G652A probably damaging Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Dars T C 1: 128,376,265 N242D probably null Het
Dnah10 T C 5: 124,800,882 L2677P probably damaging Het
Dnal1 G A 12: 84,124,556 A3T probably benign Het
Dpep2 C T 8: 105,996,217 V60I Het
Ehmt2 T A 17: 34,903,363 I302N probably benign Het
Eif3a C T 19: 60,762,190 R1309Q unknown Het
Eno4 T A 19: 58,946,652 Y100N probably benign Het
Ephx2 A T 14: 66,112,153 probably null Het
Fam102a T C 2: 32,563,748 I203T probably benign Het
Fbxw14 A T 9: 109,277,216 I251K probably benign Het
Fcgbp T C 7: 28,085,494 probably null Het
Foxm1 A C 6: 128,371,708 probably null Het
Fscn3 T A 6: 28,430,329 I166N possibly damaging Het
Gdpd4 G T 7: 97,972,128 V193L probably benign Het
Gm9573 T C 17: 35,621,180 T705A unknown Het
Gnpat T G 8: 124,880,130 C352G probably benign Het
H2-Q7 T A 17: 35,439,934 Y120* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Klri1 G A 6: 129,717,107 R6C probably benign Het
Kmo T C 1: 175,649,163 V154A probably benign Het
Kmt2c A G 5: 25,354,687 L1031P probably damaging Het
Lrrc14b T G 13: 74,363,167 T265P possibly damaging Het
Lrrc2 C T 9: 110,980,886 T330I probably benign Het
Lyn T A 4: 3,783,050 S428T probably damaging Het
Mfsd8 T A 3: 40,837,115 M59L probably benign Het
Mok T A 12: 110,808,365 Q341L probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp4e A G 7: 23,320,506 I139M probably benign Het
Olfr139 T A 11: 74,044,881 Q131L possibly damaging Het
Olfr142 G A 2: 90,252,098 R297* probably null Het
Olfr577 A G 7: 102,973,338 L218P probably damaging Het
Olfr667 A T 7: 104,916,412 Y295N possibly damaging Het
Olfr741 T C 14: 50,486,235 V259A probably benign Het
Osbpl7 G A 11: 97,054,850 S312N probably damaging Het
Paxip1 A G 5: 27,772,095 L323P unknown Het
Pcdh18 T A 3: 49,745,235 H926L probably damaging Het
Pcm1 T G 8: 41,310,116 S1460R possibly damaging Het
Pdha2 A G 3: 141,211,394 S118P possibly damaging Het
Pdss1 A T 2: 22,901,812 Y86F probably benign Het
Ppargc1a A T 5: 51,473,684 D534E probably benign Het
Prune2 A G 19: 17,125,091 K2538R probably benign Het
Ptprq A T 10: 107,582,490 I1675N probably damaging Het
Rgma C T 7: 73,375,882 P3L probably benign Het
Ros1 A G 10: 52,064,672 probably null Het
Rsg1 A G 4: 141,218,219 H127R probably damaging Het
Sema4g C T 19: 44,998,971 R519W probably damaging Het
Serpinc1 T A 1: 160,993,401 F139L probably damaging Het
Slc22a29 A G 19: 8,207,332 I198T probably damaging Het
Slc4a5 T C 6: 83,303,391 V1007A probably benign Het
Sptbn1 T C 11: 30,197,783 Y17C possibly damaging Het
Tex261 C A 6: 83,775,017 probably null Het
Timmdc1 T A 16: 38,510,786 T128S probably benign Het
Tmem120b C A 5: 123,099,936 Y96* probably null Het
Tmem196 T A 12: 120,018,576 F182I possibly damaging Het
Tnxb G A 17: 34,699,207 V2365M possibly damaging Het
Tph1 T C 7: 46,653,809 silent Het
Trpc1 G A 9: 95,710,270 Q551* probably null Het
Tubgcp3 T C 8: 12,616,099 N828D probably benign Het
Unc13a C A 8: 71,656,289 G478W probably damaging Het
Usp15 T A 10: 123,125,893 T627S Het
Vmn1r115 A T 7: 20,844,219 I256N probably damaging Het
Vmn2r6 T A 3: 64,539,889 K585N probably benign Het
Vsir G T 10: 60,358,268 probably null Het
Xirp2 A G 2: 67,513,199 D1928G probably benign Het
Xylt1 A G 7: 117,650,619 Y672C probably damaging Het
Yrdc A G 4: 124,851,087 S105G probably benign Het
Zfc3h1 T A 10: 115,418,711 N1403K probably damaging Het
Zfp160 A T 17: 21,027,036 H616L probably damaging Het
Zfp637 T A 6: 117,845,291 F127I probably damaging Het
Zfp69 G T 4: 120,930,534 A528D probably damaging Het
Zpr1 T A 9: 46,278,347 L342Q possibly damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCCTTCAATCCAGCCGATG -3'
(R):5'- ATGTATCGAGACTTTTGCATGCTG -3'

Sequencing Primer
(F):5'- AGGAGTGCATGTTCCCCAAG -3'
(R):5'- AGACTTTTGCATGCTGTGGGAAAG -3'
Posted On2020-07-13