Incidental Mutation 'R8169:Fcgbp'
ID 633962
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8169 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28071236-28120862 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 28085494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably null
Transcript: ENSMUST00000076648
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138392
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik C A 5: 139,364,057 G79V probably damaging Het
4930562C15Rik T A 16: 4,866,218 Y226N probably benign Het
6430573F11Rik A T 8: 36,511,703 K153N probably damaging Het
Bach1 G A 16: 87,722,502 C560Y possibly damaging Het
BC049730 T A 7: 24,712,575 M60K probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Casq2 G T 3: 102,110,312 A103S possibly damaging Het
Cfap100 A G 6: 90,417,674 F57S Het
Clca2 A T 3: 145,077,892 L654Q probably damaging Het
Cntnap5c T A 17: 58,104,770 probably null Het
Crtc2 G C 3: 90,263,576 G652A probably damaging Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Dars T C 1: 128,376,265 N242D probably null Het
Dnah10 T C 5: 124,800,882 L2677P probably damaging Het
Dnal1 G A 12: 84,124,556 A3T probably benign Het
Dpep2 C T 8: 105,996,217 V60I Het
Ehmt2 T A 17: 34,903,363 I302N probably benign Het
Eif3a C T 19: 60,762,190 R1309Q unknown Het
Eno4 T A 19: 58,946,652 Y100N probably benign Het
Ephx2 A T 14: 66,112,153 probably null Het
Fam102a T C 2: 32,563,748 I203T probably benign Het
Fbxw14 A T 9: 109,277,216 I251K probably benign Het
Foxm1 A C 6: 128,371,708 probably null Het
Fscn3 T A 6: 28,430,329 I166N possibly damaging Het
Gdpd4 G T 7: 97,972,128 V193L probably benign Het
Gm9573 T C 17: 35,621,180 T705A unknown Het
Gnpat T G 8: 124,880,130 C352G probably benign Het
H2-Q7 T A 17: 35,439,934 Y120* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Klri1 G A 6: 129,717,107 R6C probably benign Het
Kmo T C 1: 175,649,163 V154A probably benign Het
Kmt2c A G 5: 25,354,687 L1031P probably damaging Het
Lrrc14b T G 13: 74,363,167 T265P possibly damaging Het
Lrrc2 C T 9: 110,980,886 T330I probably benign Het
Lyn T A 4: 3,783,050 S428T probably damaging Het
Mfsd8 T A 3: 40,837,115 M59L probably benign Het
Mok T A 12: 110,808,365 Q341L probably benign Het
Myh3 C A 11: 67,089,030 N598K probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp4e A G 7: 23,320,506 I139M probably benign Het
Olfr139 T A 11: 74,044,881 Q131L possibly damaging Het
Olfr142 G A 2: 90,252,098 R297* probably null Het
Olfr577 A G 7: 102,973,338 L218P probably damaging Het
Olfr667 A T 7: 104,916,412 Y295N possibly damaging Het
Olfr741 T C 14: 50,486,235 V259A probably benign Het
Osbpl7 G A 11: 97,054,850 S312N probably damaging Het
Paxip1 A G 5: 27,772,095 L323P unknown Het
Pcdh18 T A 3: 49,745,235 H926L probably damaging Het
Pcm1 T G 8: 41,310,116 S1460R possibly damaging Het
Pdha2 A G 3: 141,211,394 S118P possibly damaging Het
Pdss1 A T 2: 22,901,812 Y86F probably benign Het
Ppargc1a A T 5: 51,473,684 D534E probably benign Het
Prune2 A G 19: 17,125,091 K2538R probably benign Het
Ptprq A T 10: 107,582,490 I1675N probably damaging Het
Rgma C T 7: 73,375,882 P3L probably benign Het
Ros1 A G 10: 52,064,672 probably null Het
Rsg1 A G 4: 141,218,219 H127R probably damaging Het
Sema4g C T 19: 44,998,971 R519W probably damaging Het
Serpinc1 T A 1: 160,993,401 F139L probably damaging Het
Slc22a29 A G 19: 8,207,332 I198T probably damaging Het
Slc4a5 T C 6: 83,303,391 V1007A probably benign Het
Sptbn1 T C 11: 30,197,783 Y17C possibly damaging Het
Tex261 C A 6: 83,775,017 probably null Het
Timmdc1 T A 16: 38,510,786 T128S probably benign Het
Tmem120b C A 5: 123,099,936 Y96* probably null Het
Tmem196 T A 12: 120,018,576 F182I possibly damaging Het
Tnxb G A 17: 34,699,207 V2365M possibly damaging Het
Tph1 T C 7: 46,653,809 silent Het
Trpc1 G A 9: 95,710,270 Q551* probably null Het
Tubgcp3 T C 8: 12,616,099 N828D probably benign Het
Unc13a C A 8: 71,656,289 G478W probably damaging Het
Usp15 T A 10: 123,125,893 T627S Het
Vmn1r115 A T 7: 20,844,219 I256N probably damaging Het
Vmn2r6 T A 3: 64,539,889 K585N probably benign Het
Vsir G T 10: 60,358,268 probably null Het
Xirp2 A G 2: 67,513,199 D1928G probably benign Het
Xylt1 A G 7: 117,650,619 Y672C probably damaging Het
Yrdc A G 4: 124,851,087 S105G probably benign Het
Zfc3h1 T A 10: 115,418,711 N1403K probably damaging Het
Zfp160 A T 17: 21,027,036 H616L probably damaging Het
Zfp637 T A 6: 117,845,291 F127I probably damaging Het
Zfp69 G T 4: 120,930,534 A528D probably damaging Het
Zpr1 T A 9: 46,278,347 L342Q possibly damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
bilge UTSW 7 28117337 missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 28091918 missense probably benign 0.00
swill UTSW 7 28089734 missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 28104170 critical splice donor site probably null
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
R8176:Fcgbp UTSW 7 28091749 missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 28104851 missense probably damaging 1.00
R8313:Fcgbp UTSW 7 28086344 missense probably benign 0.00
R8350:Fcgbp UTSW 7 28094189 missense probably benign 0.02
R8382:Fcgbp UTSW 7 28117337 missense probably benign 0.00
R8393:Fcgbp UTSW 7 28107390 missense probably benign 0.18
R8438:Fcgbp UTSW 7 28089806 missense probably benign 0.25
R8489:Fcgbp UTSW 7 28105010 missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 28086553 missense probably damaging 1.00
R8707:Fcgbp UTSW 7 28120495 missense probably benign 0.01
R8736:Fcgbp UTSW 7 28106196 missense probably benign 0.05
R8816:Fcgbp UTSW 7 28084987 missense probably benign 0.09
R8905:Fcgbp UTSW 7 28086509 missense probably damaging 1.00
R9031:Fcgbp UTSW 7 28091483 missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 28091852 missense probably damaging 1.00
R9180:Fcgbp UTSW 7 28103773 nonsense probably null
R9262:Fcgbp UTSW 7 28120527 missense probably damaging 1.00
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 28086191 missense probably benign
Z1186:Fcgbp UTSW 7 28089755 missense probably benign
Z1186:Fcgbp UTSW 7 28091647 missense probably benign
Z1186:Fcgbp UTSW 7 28093345 missense probably benign
Z1186:Fcgbp UTSW 7 28103884 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGCCATGAATTCCTGGACC -3'
(R):5'- CAGGGGTTCTCCTCATCATC -3'

Sequencing Primer
(F):5'- GGACCCCAAGCCTTTCCTAGATG -3'
(R):5'- TAACCTCCAGTCACTCTGAACTC -3'
Posted On 2020-07-13