Incidental Mutation 'R8205:Fgd3'
ID635883
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8205 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49296347 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000048692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110086] [ENSMUST00000110087]
Predicted Effect probably benign
Transcript: ENSMUST00000048716
AA Change: D142G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: D142G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110086
AA Change: D142G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105713
Gene: ENSMUSG00000037946
AA Change: D142G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110087
AA Change: D142G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: D142G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Vmn2r98 T C 17: 19,081,163 V809A probably damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0526:Fgd3 UTSW 13 49296524 missense probably benign 0.00
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1529:Fgd3 UTSW 13 49266694 missense probably benign 0.19
R1577:Fgd3 UTSW 13 49281937 missense probably damaging 0.99
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R5753:Fgd3 UTSW 13 49274940 missense possibly damaging 0.94
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
R7383:Fgd3 UTSW 13 49268309 missense possibly damaging 0.50
Z1176:Fgd3 UTSW 13 49281826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTATCAGGGTGCTCCTC -3'
(R):5'- GGAATTGACAGCCCATCCTC -3'

Sequencing Primer
(F):5'- TATCAGGGTGCTCCTCCGAGTC -3'
(R):5'- CAGTGTGGCCAGTGAGAACTTC -3'
Posted On2020-07-13