Incidental Mutation 'R8207:Riok1'
List |< first << previous [record 31 of 47] next >> last >|
ID635975
Institutional Source Beutler Lab
Gene Symbol Riok1
Ensembl Gene ENSMUSG00000021428
Gene NameRIO kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location38036995-38061433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38052320 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 347 (H347Q)
Ref Sequence ENSEMBL: ENSMUSP00000021866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021866]
Predicted Effect probably damaging
Transcript: ENSMUST00000021866
AA Change: H347Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021866
Gene: ENSMUSG00000021428
AA Change: H347Q

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
RIO 150 386 5.1e-134 SMART
Blast:RIO 465 531 4e-12 BLAST
low complexity region 551 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Riok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Riok1 APN 13 38059956 missense possibly damaging 0.80
IGL02675:Riok1 APN 13 38050243 missense probably damaging 0.99
IGL02892:Riok1 APN 13 38040065 splice site probably benign
IGL02952:Riok1 APN 13 38048890 missense probably damaging 1.00
IGL03386:Riok1 APN 13 38057237 nonsense probably null
IGL03054:Riok1 UTSW 13 38047315 missense probably damaging 1.00
R0959:Riok1 UTSW 13 38057173 missense probably damaging 0.96
R1423:Riok1 UTSW 13 38049114 missense probably damaging 1.00
R1558:Riok1 UTSW 13 38050855 missense probably damaging 1.00
R1624:Riok1 UTSW 13 38037511 missense probably damaging 1.00
R1717:Riok1 UTSW 13 38052950 missense probably damaging 1.00
R1858:Riok1 UTSW 13 38058718 nonsense probably null
R1920:Riok1 UTSW 13 38057201 missense probably benign 0.27
R2857:Riok1 UTSW 13 38049077 missense probably damaging 1.00
R4179:Riok1 UTSW 13 38048955 missense probably damaging 1.00
R7052:Riok1 UTSW 13 38037015 unclassified probably benign
R7354:Riok1 UTSW 13 38047312 missense probably benign 0.15
R7689:Riok1 UTSW 13 38045287 missense probably damaging 1.00
R8432:Riok1 UTSW 13 38037492 missense probably benign 0.01
Z1176:Riok1 UTSW 13 38058723 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCTCCTTCAGCAAATCCTG -3'
(R):5'- TCCCACTTCAAGTGTCAAGAC -3'

Sequencing Primer
(F):5'- TGCCAGCATGTAATACCATAACTG -3'
(R):5'- AGTGTCAAGACCTTATCCCAGTG -3'
Posted On2020-07-13