Incidental Mutation 'R8217:Aph1b'
ID636428
Institutional Source Beutler Lab
Gene Symbol Aph1b
Ensembl Gene ENSMUSG00000032375
Gene Nameaph1 homolog B, gamma secretase subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location66775202-66795490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66779272 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 239 (K239E)
Ref Sequence ENSEMBL: ENSMUSP00000034934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034934] [ENSMUST00000113730] [ENSMUST00000168309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034934
AA Change: K239E

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034934
Gene: ENSMUSG00000032375
AA Change: K239E

DomainStartEndE-ValueType
Pfam:Aph-1 2 238 4.1e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113730
AA Change: K198E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109359
Gene: ENSMUSG00000032375
AA Change: K198E

DomainStartEndE-ValueType
Pfam:Aph-1 2 119 2.7e-48 PFAM
Pfam:Aph-1 110 204 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168309
SMART Domains Protein: ENSMUSP00000125816
Gene: ENSMUSG00000032375

DomainStartEndE-ValueType
Pfam:Aph-1 2 172 7.8e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that is a functional component of the gamma-secretase complex, which also contains presenilin and nicastrin. This protein represents a stabilizing cofactor for the presenilin holoprotein in the complex. The gamma-secretase complex catalyzes the cleavage of integral proteins such as notch receptors and beta-amyloid precursor protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are viable and fertile and do not show any significant aberrations in the brain, kidney, or testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Aph1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Aph1b APN 9 66790673 splice site probably benign
R0497:Aph1b UTSW 9 66790618 nonsense probably null
R0621:Aph1b UTSW 9 66779334 missense possibly damaging 0.94
R1253:Aph1b UTSW 9 66790649 nonsense probably null
R1864:Aph1b UTSW 9 66794113 missense probably benign 0.05
R2221:Aph1b UTSW 9 66784639 missense probably damaging 1.00
R2223:Aph1b UTSW 9 66784639 missense probably damaging 1.00
R3788:Aph1b UTSW 9 66794066 splice site probably benign
R4874:Aph1b UTSW 9 66790596 critical splice donor site probably null
R7497:Aph1b UTSW 9 66794119 missense probably damaging 0.98
R7652:Aph1b UTSW 9 66784541 missense probably benign 0.09
R8420:Aph1b UTSW 9 66794221 missense probably damaging 1.00
R8480:Aph1b UTSW 9 66788427 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGGACAGTTCTGTGGCTTC -3'
(R):5'- ATGTTTGTGAGACCGTCCAG -3'

Sequencing Primer
(F):5'- GTGGCTTCCAAGTTCCAAGATACAG -3'
(R):5'- GGAAGCATTGTGTATTTTCCCC -3'
Posted On2020-07-13