Incidental Mutation 'R8217:Zpld1'
ID636440
Institutional Source Beutler Lab
Gene Symbol Zpld1
Ensembl Gene ENSMUSG00000064310
Gene Namezona pellucida like domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location55225175-55297986 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 55226932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036412] [ENSMUST00000143914]
Predicted Effect probably null
Transcript: ENSMUST00000036412
SMART Domains Protein: ENSMUSP00000049012
Gene: ENSMUSG00000064310

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
ZP 43 316 2.24e-6 SMART
transmembrane domain 374 396 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000143914
SMART Domains Protein: ENSMUSP00000119774
Gene: ENSMUSG00000064310

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
ZP 43 316 2.24e-6 SMART
transmembrane domain 374 396 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Other mutations in Zpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Zpld1 APN 16 55226385 missense probably benign 0.10
IGL01380:Zpld1 APN 16 55251770 missense probably damaging 0.99
IGL02089:Zpld1 APN 16 55251611 missense probably benign 0.00
IGL03350:Zpld1 APN 16 55241329 splice site probably benign
whirl UTSW 16 55233630 missense probably damaging 1.00
R0324:Zpld1 UTSW 16 55251615 missense probably damaging 1.00
R1296:Zpld1 UTSW 16 55248334 missense probably damaging 0.99
R1500:Zpld1 UTSW 16 55233572 missense probably damaging 0.97
R3712:Zpld1 UTSW 16 55226436 nonsense probably null
R4096:Zpld1 UTSW 16 55233518 missense probably damaging 1.00
R4835:Zpld1 UTSW 16 55248255 missense probably damaging 0.99
R5153:Zpld1 UTSW 16 55246644 missense probably damaging 1.00
R5412:Zpld1 UTSW 16 55232283 missense possibly damaging 0.72
R5527:Zpld1 UTSW 16 55226362 missense probably benign 0.06
R5537:Zpld1 UTSW 16 55233640 missense possibly damaging 0.84
R6167:Zpld1 UTSW 16 55233599 missense probably damaging 1.00
R6178:Zpld1 UTSW 16 55233630 missense probably damaging 1.00
R6788:Zpld1 UTSW 16 55232240 missense possibly damaging 0.93
R6877:Zpld1 UTSW 16 55251671 missense probably damaging 0.99
R7165:Zpld1 UTSW 16 55232231 missense probably benign 0.03
R7382:Zpld1 UTSW 16 55246683 critical splice acceptor site probably null
R7423:Zpld1 UTSW 16 55233664 missense probably damaging 1.00
R8377:Zpld1 UTSW 16 55246654 missense probably benign 0.04
Z1176:Zpld1 UTSW 16 55251765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATCAGAAGTTTGATATCCCAG -3'
(R):5'- GAATACTCCATGGACCTCGG -3'

Sequencing Primer
(F):5'- ATCAGAAGTTTGATATCCCAGTAATG -3'
(R):5'- TACTCCATGGACCTCGGGTGAG -3'
Posted On2020-07-13