Incidental Mutation 'R1533:Hecw2'
ID 166705
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene Name HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms A730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 039572-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R1533 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 53846031-54234193 bp(-) (GRCm39)
Type of Mutation splice site (4268 bp from exon)
DNA Base Change (assembly) T to A at 53965704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000097741] [ENSMUST00000120904]
AlphaFold Q6I6G8
Predicted Effect probably benign
Transcript: ENSMUST00000087659
AA Change: D374V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: D374V

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097741
SMART Domains Protein: ENSMUSP00000095348
Gene: ENSMUSG00000042807

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 1e-87 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 292 5.92e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120904
AA Change: D374V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: D374V

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G C 3: 121,928,807 (GRCm39) G1340A probably benign Het
Ambra1 T A 2: 91,717,210 (GRCm39) Y836N probably damaging Het
Arhgap26 A T 18: 39,504,130 (GRCm39) H144L probably benign Het
B3gnt5 A G 16: 19,588,364 (GRCm39) I194M probably damaging Het
Bltp1 G T 3: 37,095,524 (GRCm39) G4509V probably damaging Het
Bod1l A T 5: 41,979,498 (GRCm39) C605* probably null Het
C2cd3 G T 7: 100,055,284 (GRCm39) K482N possibly damaging Het
Cd300lg T A 11: 101,934,047 (GRCm39) L98Q probably damaging Het
Cerkl T A 2: 79,171,701 (GRCm39) I386F possibly damaging Het
Cfh T A 1: 140,028,716 (GRCm39) D466V possibly damaging Het
Crtc1 A T 8: 70,850,949 (GRCm39) I221N probably damaging Het
Ctnnbl1 T C 2: 157,678,563 (GRCm39) S389P probably benign Het
Ctsb A T 14: 63,376,544 (GRCm39) D258V probably damaging Het
Cuzd1 G T 7: 130,913,432 (GRCm39) T395N probably damaging Het
Dnah6 T C 6: 73,128,536 (GRCm39) T1240A probably benign Het
Dok7 T A 5: 35,221,671 (GRCm39) probably null Het
Dscaml1 T C 9: 45,361,882 (GRCm39) V214A probably damaging Het
Enpp6 A T 8: 47,518,469 (GRCm39) Y199F probably benign Het
Entpd5 C A 12: 84,441,434 (GRCm39) K111N probably damaging Het
Fam98a A G 17: 75,848,276 (GRCm39) L146S probably damaging Het
Fhod3 A T 18: 25,248,921 (GRCm39) I1367F probably damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fpr3 T A 17: 18,190,922 (GRCm39) Y64* probably null Het
Fzd6 A T 15: 38,895,019 (GRCm39) H395L probably damaging Het
Gcsh T A 8: 117,715,921 (GRCm39) H54L probably damaging Het
Gsdma T A 11: 98,567,210 (GRCm39) S437T unknown Het
Gzmc A G 14: 56,471,376 (GRCm39) V55A probably damaging Het
Ifi207 A G 1: 173,555,306 (GRCm39) V792A probably benign Het
Itpr3 C A 17: 27,314,534 (GRCm39) N661K possibly damaging Het
Jmy A T 13: 93,577,819 (GRCm39) I783N probably benign Het
Kcmf1 T C 6: 72,820,003 (GRCm39) E281G possibly damaging Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Lgr6 T A 1: 135,032,670 (GRCm39) Y70F possibly damaging Het
Lnx1 T G 5: 74,780,678 (GRCm39) D330A probably damaging Het
Lrp5 T C 19: 3,664,234 (GRCm39) N106S probably benign Het
Mamdc4 C A 2: 25,459,759 (GRCm39) R135L possibly damaging Het
Mcm3ap A G 10: 76,340,121 (GRCm39) E1464G probably damaging Het
Megf8 T C 7: 25,034,280 (GRCm39) V666A possibly damaging Het
Mettl3 T A 14: 52,534,385 (GRCm39) E331D probably benign Het
Mphosph9 T C 5: 124,405,204 (GRCm39) K789R probably damaging Het
Mtf2 T C 5: 108,239,995 (GRCm39) L234P probably damaging Het
Ncdn C A 4: 126,642,491 (GRCm39) E389* probably null Het
Ndor1 A G 2: 25,139,279 (GRCm39) S231P probably damaging Het
Nelfa T G 5: 34,056,215 (GRCm39) K483Q probably damaging Het
Odad1 T A 7: 45,592,282 (GRCm39) M354K probably benign Het
Opn1sw C T 6: 29,378,923 (GRCm39) R243Q probably benign Het
Or13a24 T A 7: 140,155,034 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,792 (GRCm39) N284S probably damaging Het
Pik3cd T C 4: 149,739,653 (GRCm39) E584G probably damaging Het
Plcb3 A T 19: 6,935,041 (GRCm39) M870K possibly damaging Het
Poc5 A G 13: 96,528,152 (GRCm39) D16G probably damaging Het
Prpf40a A G 2: 53,035,852 (GRCm39) I633T probably damaging Het
Ptpn13 G T 5: 103,704,044 (GRCm39) E1359* probably null Het
Ptprr C A 10: 116,024,113 (GRCm39) Y4* probably null Het
Rbm45 T C 2: 76,202,503 (GRCm39) probably null Het
Rfng C T 11: 120,672,687 (GRCm39) W320* probably null Het
Rgs6 G T 12: 83,138,547 (GRCm39) V294L probably benign Het
Rufy4 T C 1: 74,169,002 (GRCm39) probably null Het
Ruvbl2 T A 7: 45,073,566 (GRCm39) N313I probably damaging Het
Sema4g G A 19: 44,981,256 (GRCm39) V70M probably damaging Het
Siglec1 T C 2: 130,918,078 (GRCm39) T969A probably benign Het
Slc22a27 T A 19: 7,844,348 (GRCm39) T431S possibly damaging Het
Slc25a16 G A 10: 62,756,643 (GRCm39) R38H probably damaging Het
Slc38a6 T C 12: 73,391,626 (GRCm39) V296A probably benign Het
Slc39a11 C T 11: 113,196,748 (GRCm39) V212I probably damaging Het
Sltm A G 9: 70,493,948 (GRCm39) K782E probably damaging Het
Styxl1 T A 5: 135,799,175 (GRCm39) Y23F probably damaging Het
Svs4 T C 2: 164,120,148 (GRCm39) I20V unknown Het
Syt14 G T 1: 192,613,084 (GRCm39) T572K possibly damaging Het
Tbc1d5 A T 17: 51,227,603 (GRCm39) I214N possibly damaging Het
Tm9sf3 A G 19: 41,227,223 (GRCm39) S283P probably benign Het
Tmtc1 C T 6: 148,147,208 (GRCm39) probably null Het
Ttll7 T A 3: 146,602,422 (GRCm39) N73K probably damaging Het
Ttn T A 2: 76,602,802 (GRCm39) K18473N probably damaging Het
Ubr2 A C 17: 47,278,173 (GRCm39) Y721* probably null Het
Vmn1r14 T A 6: 57,211,286 (GRCm39) I288N probably damaging Het
Vmn2r103 T C 17: 19,993,662 (GRCm39) I13T probably benign Het
Vps13a A T 19: 16,678,494 (GRCm39) Y1162* probably null Het
Vps51 C A 19: 6,121,497 (GRCm39) R175L probably benign Het
Zfp523 C A 17: 28,423,473 (GRCm39) S149R probably benign Het
Zik1 A G 7: 10,224,053 (GRCm39) I348T possibly damaging Het
Znfx1 T A 2: 166,898,708 (GRCm39) H72L probably benign Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53,869,896 (GRCm39) missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53,867,040 (GRCm39) splice site probably benign
IGL00530:Hecw2 APN 1 53,892,439 (GRCm39) missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53,866,135 (GRCm39) missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53,866,120 (GRCm39) missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53,879,951 (GRCm39) missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53,870,702 (GRCm39) missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53,965,670 (GRCm39) missense probably benign
IGL02085:Hecw2 APN 1 53,981,961 (GRCm39) critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53,972,407 (GRCm39) missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53,963,075 (GRCm39) missense probably null 0.38
IGL02388:Hecw2 APN 1 53,964,858 (GRCm39) missense probably benign 0.17
IGL02499:Hecw2 APN 1 53,965,647 (GRCm39) missense probably benign
IGL02695:Hecw2 APN 1 53,965,368 (GRCm39) missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53,965,847 (GRCm39) splice site probably benign
IGL03100:Hecw2 APN 1 53,870,815 (GRCm39) missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53,965,416 (GRCm39) missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53,871,875 (GRCm39) missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53,966,217 (GRCm39) splice site probably benign
Memoriam UTSW 1 53,965,215 (GRCm39) missense probably benign
recollect UTSW 1 53,943,581 (GRCm39) missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53,964,853 (GRCm39) missense probably benign 0.01
R0077:Hecw2 UTSW 1 53,907,990 (GRCm39) splice site probably benign
R0133:Hecw2 UTSW 1 53,869,899 (GRCm39) missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53,965,857 (GRCm39) splice site probably benign
R1303:Hecw2 UTSW 1 54,079,552 (GRCm39) missense probably benign 0.00
R1460:Hecw2 UTSW 1 53,852,404 (GRCm39) missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53,890,777 (GRCm39) missense probably damaging 1.00
R1828:Hecw2 UTSW 1 53,965,182 (GRCm39) missense probably benign
R2170:Hecw2 UTSW 1 53,981,956 (GRCm39) missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53,943,581 (GRCm39) missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53,869,839 (GRCm39) missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53,871,916 (GRCm39) splice site probably benign
R3892:Hecw2 UTSW 1 53,965,280 (GRCm39) missense probably benign 0.01
R4086:Hecw2 UTSW 1 53,870,815 (GRCm39) missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53,852,381 (GRCm39) makesense probably null
R4805:Hecw2 UTSW 1 53,880,018 (GRCm39) missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53,869,911 (GRCm39) missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53,990,000 (GRCm39) missense probably benign 0.03
R4983:Hecw2 UTSW 1 53,871,830 (GRCm39) missense probably benign 0.42
R5168:Hecw2 UTSW 1 53,952,459 (GRCm39) missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53,965,360 (GRCm39) missense probably benign 0.09
R5549:Hecw2 UTSW 1 53,964,850 (GRCm39) missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53,871,782 (GRCm39) missense probably null 1.00
R5740:Hecw2 UTSW 1 53,926,762 (GRCm39) missense probably benign 0.12
R5919:Hecw2 UTSW 1 53,976,249 (GRCm39) missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53,963,135 (GRCm39) missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53,907,992 (GRCm39) splice site probably null
R6875:Hecw2 UTSW 1 53,976,291 (GRCm39) missense probably benign 0.01
R7097:Hecw2 UTSW 1 53,904,283 (GRCm39) missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53,904,280 (GRCm39) missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53,953,753 (GRCm39) missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53,943,502 (GRCm39) missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54,079,629 (GRCm39) missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53,953,031 (GRCm39) critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53,965,215 (GRCm39) missense probably benign
R7611:Hecw2 UTSW 1 53,952,459 (GRCm39) missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54,079,546 (GRCm39) missense probably benign 0.37
R8286:Hecw2 UTSW 1 53,879,928 (GRCm39) missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53,926,775 (GRCm39) missense probably null 0.07
R8354:Hecw2 UTSW 1 53,964,467 (GRCm39) critical splice donor site probably null
R8362:Hecw2 UTSW 1 54,079,650 (GRCm39) start codon destroyed probably null 0.51
R8691:Hecw2 UTSW 1 53,904,223 (GRCm39) missense probably benign 0.26
R8745:Hecw2 UTSW 1 53,972,330 (GRCm39) missense probably damaging 1.00
R8769:Hecw2 UTSW 1 53,952,507 (GRCm39) missense probably benign 0.00
R8830:Hecw2 UTSW 1 53,930,305 (GRCm39) missense probably damaging 1.00
R8842:Hecw2 UTSW 1 53,990,033 (GRCm39) missense
R8874:Hecw2 UTSW 1 53,943,608 (GRCm39) splice site probably benign
R9064:Hecw2 UTSW 1 53,866,045 (GRCm39) missense probably benign 0.08
R9326:Hecw2 UTSW 1 54,079,369 (GRCm39) missense probably damaging 1.00
R9450:Hecw2 UTSW 1 53,878,188 (GRCm39) nonsense probably null
R9486:Hecw2 UTSW 1 53,852,466 (GRCm39) missense probably damaging 1.00
R9763:Hecw2 UTSW 1 53,963,074 (GRCm39) missense probably damaging 1.00
R9766:Hecw2 UTSW 1 53,904,287 (GRCm39) missense probably damaging 1.00
Z1177:Hecw2 UTSW 1 53,963,102 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGGGGCCATTGTGTTCAATAGCATC -3'
(R):5'- TTCTAGCAGCCAGTGACACGTCAG -3'

Sequencing Primer
(F):5'- CTAAGTAATCATTGAGGGAATCCTGG -3'
(R):5'- AGTCACCTTTGGGATGACTGAAC -3'
Posted On 2014-04-13