Incidental Mutation 'R5482:Hecw2'
ID 434366
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene Name HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms A730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 043043-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R5482 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 53846031-54234193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53965360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 489 (M489L)
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000097741] [ENSMUST00000120904]
AlphaFold Q6I6G8
Predicted Effect probably benign
Transcript: ENSMUST00000087659
AA Change: M489L

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: M489L

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097741
SMART Domains Protein: ENSMUSP00000095348
Gene: ENSMUSG00000042807

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 1e-87 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 292 5.92e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120904
AA Change: M489L

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: M489L

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230109A22Rik T C 15: 25,139,036 (GRCm39) noncoding transcript Het
Abca15 T C 7: 119,968,370 (GRCm39) L801P probably damaging Het
Acap3 A G 4: 155,984,613 (GRCm39) D212G probably benign Het
Acsl6 G A 11: 54,217,964 (GRCm39) D166N probably damaging Het
Acy1 T C 9: 106,311,838 (GRCm39) probably benign Het
Adgrl3 A G 5: 81,942,360 (GRCm39) N1368S probably damaging Het
Akap5 T C 12: 76,375,600 (GRCm39) I344T probably benign Het
Aplp1 A G 7: 30,139,600 (GRCm39) F399S probably damaging Het
Arap3 A G 18: 38,107,727 (GRCm39) S1302P possibly damaging Het
Bik T G 15: 83,428,335 (GRCm39) V121G probably damaging Het
Birc6 A T 17: 74,948,777 (GRCm39) M3069L possibly damaging Het
Birc6 A G 17: 74,969,685 (GRCm39) T4237A probably damaging Het
Btn2a2 T C 13: 23,670,557 (GRCm39) N59D probably benign Het
Cabyr A G 18: 12,884,496 (GRCm39) S328G possibly damaging Het
Cfap57 C T 4: 118,426,838 (GRCm39) G1067R probably benign Het
Cryl1 A T 14: 57,550,469 (GRCm39) F132I probably damaging Het
Dipk1a C G 5: 108,057,529 (GRCm39) C343S probably damaging Het
Dnah8 G A 17: 31,019,521 (GRCm39) E3865K probably damaging Het
Dock3 G A 9: 106,855,937 (GRCm39) R741* probably null Het
Fsip2 C T 2: 82,815,654 (GRCm39) L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 (GRCm39) Y39S probably benign Het
Gm5535 C A 2: 144,016,492 (GRCm39) noncoding transcript Het
Gmcl1 A T 6: 86,695,055 (GRCm39) M202K probably damaging Het
Lrrk1 A G 7: 65,980,418 (GRCm39) I254T probably benign Het
Lrrn3 A C 12: 41,502,387 (GRCm39) C643W probably damaging Het
Lrrn3 G A 12: 41,502,386 (GRCm39) L644F probably benign Het
Nr2f6 A T 8: 71,827,182 (GRCm39) I373N probably damaging Het
Nt5dc3 A G 10: 86,647,395 (GRCm39) Y130C probably damaging Het
Or5b12 T C 19: 12,897,269 (GRCm39) T135A probably damaging Het
Or6c3 T C 10: 129,308,947 (GRCm39) Y129H probably benign Het
Otogl T A 10: 107,657,802 (GRCm39) I1043F probably damaging Het
Padi3 G A 4: 140,523,154 (GRCm39) T302I probably damaging Het
Pcdhgb5 A G 18: 37,864,585 (GRCm39) N127D probably damaging Het
Pign A G 1: 105,474,435 (GRCm39) F876L probably benign Het
Pip5k1c A G 10: 81,128,897 (GRCm39) E2G probably damaging Het
Ppp1r18 G A 17: 36,184,771 (GRCm39) E141K probably damaging Het
Ralbp1 A C 17: 66,168,563 (GRCm39) Y247* probably null Het
Ripply2 A G 9: 86,897,620 (GRCm39) E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,785,191 (GRCm39) probably null Het
Skint2 T G 4: 112,483,076 (GRCm39) C160W probably damaging Het
Sun2 C T 15: 79,621,712 (GRCm39) R172Q probably benign Het
Syna A G 5: 134,588,028 (GRCm39) L307P possibly damaging Het
Tlcd3b A G 7: 126,426,660 (GRCm39) T78A possibly damaging Het
Trappc12 T C 12: 28,741,324 (GRCm39) K795R probably damaging Het
Trmt9b A T 8: 36,979,203 (GRCm39) M269L probably benign Het
Ttll11 A G 2: 35,642,418 (GRCm39) S638P probably damaging Het
Usp2 G A 9: 44,000,480 (GRCm39) probably null Het
Vmn2r26 A T 6: 124,038,285 (GRCm39) E620V possibly damaging Het
Wdr36 A T 18: 32,974,957 (GRCm39) H103L probably benign Het
Wnt5b T C 6: 119,423,392 (GRCm39) T78A probably benign Het
Zc2hc1b C T 10: 13,029,270 (GRCm39) R146Q probably damaging Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53,869,896 (GRCm39) missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53,867,040 (GRCm39) splice site probably benign
IGL00530:Hecw2 APN 1 53,892,439 (GRCm39) missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53,866,135 (GRCm39) missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53,866,120 (GRCm39) missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53,879,951 (GRCm39) missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53,870,702 (GRCm39) missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53,965,670 (GRCm39) missense probably benign
IGL02085:Hecw2 APN 1 53,981,961 (GRCm39) critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53,972,407 (GRCm39) missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53,963,075 (GRCm39) missense probably null 0.38
IGL02388:Hecw2 APN 1 53,964,858 (GRCm39) missense probably benign 0.17
IGL02499:Hecw2 APN 1 53,965,647 (GRCm39) missense probably benign
IGL02695:Hecw2 APN 1 53,965,368 (GRCm39) missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53,965,847 (GRCm39) splice site probably benign
IGL03100:Hecw2 APN 1 53,870,815 (GRCm39) missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53,965,416 (GRCm39) missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53,871,875 (GRCm39) missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53,966,217 (GRCm39) splice site probably benign
Memoriam UTSW 1 53,965,215 (GRCm39) missense probably benign
recollect UTSW 1 53,943,581 (GRCm39) missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53,964,853 (GRCm39) missense probably benign 0.01
R0077:Hecw2 UTSW 1 53,907,990 (GRCm39) splice site probably benign
R0133:Hecw2 UTSW 1 53,869,899 (GRCm39) missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53,965,857 (GRCm39) splice site probably benign
R1303:Hecw2 UTSW 1 54,079,552 (GRCm39) missense probably benign 0.00
R1460:Hecw2 UTSW 1 53,852,404 (GRCm39) missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53,890,777 (GRCm39) missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53,965,704 (GRCm39) splice site probably null
R1828:Hecw2 UTSW 1 53,965,182 (GRCm39) missense probably benign
R2170:Hecw2 UTSW 1 53,981,956 (GRCm39) missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53,943,581 (GRCm39) missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53,869,839 (GRCm39) missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53,871,916 (GRCm39) splice site probably benign
R3892:Hecw2 UTSW 1 53,965,280 (GRCm39) missense probably benign 0.01
R4086:Hecw2 UTSW 1 53,870,815 (GRCm39) missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53,871,804 (GRCm39) missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53,852,381 (GRCm39) makesense probably null
R4805:Hecw2 UTSW 1 53,880,018 (GRCm39) missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53,869,911 (GRCm39) missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53,990,000 (GRCm39) missense probably benign 0.03
R4983:Hecw2 UTSW 1 53,871,830 (GRCm39) missense probably benign 0.42
R5168:Hecw2 UTSW 1 53,952,459 (GRCm39) missense probably damaging 1.00
R5549:Hecw2 UTSW 1 53,964,850 (GRCm39) missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53,871,782 (GRCm39) missense probably null 1.00
R5740:Hecw2 UTSW 1 53,926,762 (GRCm39) missense probably benign 0.12
R5919:Hecw2 UTSW 1 53,976,249 (GRCm39) missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53,963,135 (GRCm39) missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53,907,992 (GRCm39) splice site probably null
R6875:Hecw2 UTSW 1 53,976,291 (GRCm39) missense probably benign 0.01
R7097:Hecw2 UTSW 1 53,904,283 (GRCm39) missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53,904,280 (GRCm39) missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53,953,753 (GRCm39) missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53,943,502 (GRCm39) missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54,079,629 (GRCm39) missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53,953,031 (GRCm39) critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53,965,215 (GRCm39) missense probably benign
R7611:Hecw2 UTSW 1 53,952,459 (GRCm39) missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54,079,546 (GRCm39) missense probably benign 0.37
R8286:Hecw2 UTSW 1 53,879,928 (GRCm39) missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53,926,775 (GRCm39) missense probably null 0.07
R8354:Hecw2 UTSW 1 53,964,467 (GRCm39) critical splice donor site probably null
R8362:Hecw2 UTSW 1 54,079,650 (GRCm39) start codon destroyed probably null 0.51
R8691:Hecw2 UTSW 1 53,904,223 (GRCm39) missense probably benign 0.26
R8745:Hecw2 UTSW 1 53,972,330 (GRCm39) missense probably damaging 1.00
R8769:Hecw2 UTSW 1 53,952,507 (GRCm39) missense probably benign 0.00
R8830:Hecw2 UTSW 1 53,930,305 (GRCm39) missense probably damaging 1.00
R8842:Hecw2 UTSW 1 53,990,033 (GRCm39) missense
R8874:Hecw2 UTSW 1 53,943,608 (GRCm39) splice site probably benign
R9064:Hecw2 UTSW 1 53,866,045 (GRCm39) missense probably benign 0.08
R9326:Hecw2 UTSW 1 54,079,369 (GRCm39) missense probably damaging 1.00
R9450:Hecw2 UTSW 1 53,878,188 (GRCm39) nonsense probably null
R9486:Hecw2 UTSW 1 53,852,466 (GRCm39) missense probably damaging 1.00
R9763:Hecw2 UTSW 1 53,963,074 (GRCm39) missense probably damaging 1.00
R9766:Hecw2 UTSW 1 53,904,287 (GRCm39) missense probably damaging 1.00
Z1177:Hecw2 UTSW 1 53,963,102 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGTTGGCTTCATTTTCATCAG -3'
(R):5'- GCTATTGAACACAATGGCCC -3'

Sequencing Primer
(F):5'- TCATTTTCATCAGGGGCTGTAC -3'
(R):5'- CAAGACTCAATGCGATGC -3'
Posted On 2016-10-06