Incidental Mutation 'R8288:Mptx2'
ID638512
Institutional Source Beutler Lab
Gene Symbol Mptx2
Ensembl Gene ENSMUSG00000079180
Gene Namemucosal pentraxin 2
SynonymsGm11062
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173274382-173277777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173274789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000106855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224]
Predicted Effect probably benign
Transcript: ENSMUST00000059754
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
AA Change: V111A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180
AA Change: V111A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Mptx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mptx2 APN 1 173274888 missense probably damaging 1.00
IGL01737:Mptx2 APN 1 173274841 missense probably damaging 0.99
IGL02212:Mptx2 APN 1 173274681 missense possibly damaging 0.69
IGL03185:Mptx2 APN 1 173274789 missense possibly damaging 0.68
R1772:Mptx2 UTSW 1 173274473 missense probably damaging 0.98
R2070:Mptx2 UTSW 1 173274578 nonsense probably null
R3792:Mptx2 UTSW 1 173274673 missense probably damaging 1.00
R5673:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R5700:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R5701:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6110:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6118:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6124:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6738:Mptx2 UTSW 1 173274855 missense probably benign 0.05
R6895:Mptx2 UTSW 1 173277685 missense probably benign
R8737:Mptx2 UTSW 1 173277689 missense probably benign 0.00
R8857:Mptx2 UTSW 1 173274885 missense probably benign 0.32
RF001:Mptx2 UTSW 1 173274969 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCACCTCTTTTATGGGGAC -3'
(R):5'- TGTATAAAGGCCTTCACAGACC -3'

Sequencing Primer
(F):5'- GGGACCACATAGTTCCACAAGG -3'
(R):5'- AGACCTGACTCGCCCTTATAG -3'
Posted On2020-07-28