Mutagenetix > Incidental Mutations

Incidental Mutation 'R8288:Irs1'

638510

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R8288 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 82287961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 845 (Q845*)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069799
AA Change: Q845*

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: Q845*

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	C	T	8: 22,793,137	A200T	probably benign	Het
Arpp19	T	C	9: 75,037,632	M1T	probably null	Het
Baiap2	T	A	11: 119,997,639	V407E	probably damaging	Het
Cdh18	A	G	15: 23,445,987	T508A	probably damaging	Het
Cnnm3	C	A	1: 36,511,993	A28E	possibly damaging	Het
Cpb1	A	T	3: 20,265,367	C184*	probably null	Het
Ddb1	T	C	19: 10,608,348	V142A	probably benign	Het
Disp2	T	C	2: 118,790,281	V498A	probably damaging	Het
Dmgdh	T	C	13: 93,708,824	Y442H	probably damaging	Het
Eef2k	T	A	7: 120,903,381	M722K	probably damaging	Het
Erbb4	A	G	1: 68,298,350	F603S	probably damaging	Het
Filip1l	C	T	16: 57,570,554	R502C	probably damaging	Het
Gbp9	C	T	5: 105,105,733	V39M	probably damaging	Het
Gm17079	T	C	14: 51,694,358	Y98C		Het
Gstz1	A	G	12: 87,147,830	M1V	probably null	Het
Hsd17b13	T	G	5: 103,963,835	I281L	probably benign	Het
Hydin	A	G	8: 110,507,029	E1833G	probably damaging	Het
Kctd11	C	T	11: 69,880,057	G52R	probably damaging	Het
Kit	T	C	5: 75,654,489	S962P	probably damaging	Het
Lrrn1	C	T	6: 107,566,994		probably benign	Het
Mastl	T	C	2: 23,133,359	K451E	probably damaging	Het
Mptx2	A	G	1: 173,274,789	V111A	probably benign	Het
Nuak2	G	T	1: 132,327,841	C178F	probably damaging	Het
Pah	G	A	10: 87,538,185	R71H	probably benign	Het
Pclo	C	A	5: 14,712,871	T501K		Het
Pla2g4e	C	T	2: 120,188,509		probably null	Het
Polq	A	G	16: 37,027,910	E293G	probably damaging	Het
Rptor	G	A	11: 119,857,937	E782K	probably benign	Het
Scn7a	T	A	2: 66,675,974	R1524W	probably damaging	Het
Slc4a5	T	C	6: 83,226,255	S46P	probably benign	Het
Srcap	T	A	7: 127,531,356	I664N	probably damaging	Het
Stk24	A	C	14: 121,293,429	F372V	possibly damaging	Het
Szt2	T	C	4: 118,389,776	S881G	probably damaging	Het
Trim40	T	C	17: 36,883,318	D161G	probably benign	Het
Trip11	T	C	12: 101,894,384	H234R	possibly damaging	Het
Trpc1	T	C	9: 95,721,381	K366R	probably damaging	Het
Ugt2b35	T	C	5: 87,001,457	L189P	probably damaging	Het
Unc80	A	G	1: 66,473,350	S140G	probably benign	Het
Wdr60	A	G	12: 116,213,725	F811S	probably damaging	Het
Zfp446	A	G	7: 12,977,958	E36G	probably benign	Het
Zfp738	T	A	13: 67,670,789	H361L	possibly damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TGCAGGGCCAGCTAAATAG -3'
(R):5'- GTCCTTTAAGCACACCCAGC -3'

Sequencing Primer
(F):5'- CACATATTCTCCTGGGCTTT -3'
(R):5'- AGGCACCAGCATCTTCGTC -3'

Posted On

2020-07-28