Incidental Mutation 'R8374:Rptn'
ID646568
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8374 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 93396295 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 312 (G312*)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect probably null
Transcript: ENSMUST00000045912
AA Change: G312*
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: G312*

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,902,706 G721E probably benign Het
Aip A T 19: 4,115,456 M170K probably damaging Het
Alms1 T C 6: 85,608,991 I276T probably benign Het
Arid1b C T 17: 5,342,644 P2097S possibly damaging Het
Astn1 T G 1: 158,502,233 N219K probably damaging Het
Cbx2 G T 11: 119,028,143 R178L probably damaging Het
Clptm1 G A 7: 19,638,156 P252S probably benign Het
Crebbp A G 16: 4,084,311 S2355P probably damaging Het
D130043K22Rik C A 13: 24,857,979 T297K probably benign Het
Ddx60 A G 8: 61,974,171 D760G probably benign Het
Dgka T C 10: 128,721,243 N621S probably benign Het
Ear10 A T 14: 43,923,188 C61S probably damaging Het
F12 A T 13: 55,421,331 C238S probably damaging Het
Fen1 A G 19: 10,200,460 F207L probably benign Het
Fzr1 A G 10: 81,367,534 L486P probably damaging Het
Gdnf A G 15: 7,834,695 R196G probably benign Het
Gldc A C 19: 30,137,194 F439V probably damaging Het
Gm3138 T C 14: 4,251,688 M120T probably damaging Het
Gpi1 G A 7: 34,220,657 A197V probably benign Het
Ighv1-4 T A 12: 114,487,279 I70F probably benign Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Kank1 A T 19: 25,411,641 I893F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif13b T C 14: 64,788,435 S1414P probably damaging Het
Mettl11b A T 1: 163,703,048 M274K probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mosmo T A 7: 120,730,492 M112K probably benign Het
Olfr317 T A 11: 58,732,898 D89V probably damaging Het
Olfr715b A G 7: 107,106,826 F12L probably damaging Het
Olfr93 C A 17: 37,151,745 V76F probably damaging Het
Pak6 G A 2: 118,693,996 V497I probably benign Het
Ppargc1b G A 18: 61,310,493 S549F probably damaging Het
Rassf8 T A 6: 145,815,137 L63* probably null Het
Rsph14 T C 10: 74,961,649 I169V probably benign Het
Sltm A G 9: 70,561,945 D162G probably null Het
Tatdn1 C T 15: 58,916,151 probably null Het
Tbx4 A C 11: 85,914,276 E397A probably benign Het
Tdrd12 T C 7: 35,478,061 D956G unknown Het
Tnr G A 1: 159,858,383 V395I probably benign Het
Ugt1a2 A T 1: 88,201,385 H250L possibly damaging Het
Vmn1r173 C T 7: 23,702,495 H52Y probably damaging Het
Vps11 T C 9: 44,356,409 D302G probably benign Het
Zfp398 T C 6: 47,859,534 probably null Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
R8161:Rptn UTSW 3 93396693 small deletion probably benign
R8671:Rptn UTSW 3 93398194 missense probably benign 0.18
R8804:Rptn UTSW 3 93395843 missense probably damaging 0.98
R8934:Rptn UTSW 3 93395912 missense probably benign 0.00
R8938:Rptn UTSW 3 93395025 missense possibly damaging 0.93
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCCAGTCTAAAACATCTGGAC -3'
(R):5'- TTTCTGACCCTGGTGAGGAC -3'

Sequencing Primer
(F):5'- CAAAGCAGTCATGGTCAGTCTG -3'
(R):5'- AGGACTCTGGTCTTGTCTGCC -3'
Posted On2020-09-02