Incidental Mutation 'R8804:Rptn'
ID671899
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8804 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93395843 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 161 (D161V)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect probably damaging
Transcript: ENSMUST00000045912
AA Change: D161V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: D161V

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,656 probably benign Het
Adamts1 A G 16: 85,802,412 F100S probably damaging Het
Adamts5 A G 16: 85,869,912 probably benign Het
Adgrb2 T A 4: 130,005,419 W309R probably damaging Het
Adgrl2 A T 3: 148,847,016 V617E probably damaging Het
Akt1 T C 12: 112,658,607 E169G probably damaging Het
Arhgap40 A G 2: 158,547,706 T600A probably benign Het
B4galt3 C T 1: 171,276,374 H395Y probably benign Het
BC024139 T G 15: 76,124,084 T376P possibly damaging Het
Bin3 A G 14: 70,123,847 R22G probably damaging Het
Cadps2 A T 6: 23,496,806 I480N probably damaging Het
Camsap3 A G 8: 3,602,624 T401A probably benign Het
Cdhr5 T C 7: 141,269,407 T747A probably benign Het
Chn2 A G 6: 54,273,076 I193V probably benign Het
Clca3b T C 3: 144,839,137 N363S probably benign Het
Clec7a T C 6: 129,465,555 T125A probably benign Het
Cys1 A T 12: 24,668,611 L81Q unknown Het
Dcbld2 G A 16: 58,461,049 probably benign Het
Ddx60 T A 8: 61,958,606 D497E probably benign Het
Dnah2 T C 11: 69,465,685 I2117V probably benign Het
Dnah6 G A 6: 73,065,773 S3274F probably benign Het
Dock9 A T 14: 121,605,183 I1225N probably damaging Het
Egfr A G 11: 16,869,339 T290A probably benign Het
Elmod2 T A 8: 83,319,521 K142N probably benign Het
Ephx2 T C 14: 66,087,020 T441A probably benign Het
Fam234a A G 17: 26,216,557 probably benign Het
Fer1l4 C A 2: 156,051,994 E102D probably benign Het
Fermt3 A G 19: 7,014,326 probably benign Het
Fgd5 C T 6: 91,987,526 R247C probably benign Het
Gm14443 G A 2: 175,169,859 H265Y probably damaging Het
Gm8251 T C 1: 44,056,649 N1763S probably benign Het
Gykl1 A G 18: 52,694,536 D272G probably benign Het
Hip1r T C 5: 124,001,512 S952P possibly damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Hrasls T A 16: 29,220,453 V95E probably benign Het
Ighv1-36 G T 12: 114,879,961 T93K probably benign Het
Igsf10 T G 3: 59,336,455 T153P probably damaging Het
Kif13b T C 14: 64,750,342 C773R probably damaging Het
Lipf T A 19: 33,964,798 Y43N probably damaging Het
Mlh1 T C 9: 111,264,904 D90G probably damaging Het
Msh5 A T 17: 35,032,854 I410K probably benign Het
Mylk3 T C 8: 85,359,245 D220G probably benign Het
Ncdn G A 4: 126,750,105 A308V probably benign Het
Nup153 A G 13: 46,687,159 V991A probably benign Het
Nup188 T A 2: 30,330,879 H960Q probably benign Het
Parp4 G T 14: 56,616,443 E839* probably null Het
Pfas T C 11: 68,991,082 N30D Het
Pitpnc1 T A 11: 107,212,605 N223Y probably damaging Het
Plod1 C T 4: 147,913,321 V644I probably damaging Het
Pou2f1 T C 1: 165,880,470 T548A unknown Het
Psg20 A T 7: 18,682,659 N177K possibly damaging Het
Psmb8 T A 17: 34,200,251 I173N probably damaging Het
Rimkla G A 4: 119,468,076 Q379* probably null Het
Rnasel G T 1: 153,753,915 G59V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scrt1 C A 15: 76,519,211 C193F unknown Het
Sdk2 G T 11: 113,873,152 Y269* probably null Het
Sfxn2 G C 19: 46,585,804 probably benign Het
Slc17a4 G T 13: 23,903,262 T264K probably benign Het
Slfn8 T A 11: 83,016,813 Q301H possibly damaging Het
Sntb1 G A 15: 55,792,127 S231F probably benign Het
Spag17 T A 3: 99,967,190 S137T probably benign Het
Srd5a2 A T 17: 74,047,634 V65E possibly damaging Het
Stk11ip A G 1: 75,535,256 H967R probably benign Het
Sun1 A G 5: 139,231,165 T320A probably benign Het
Svep1 A G 4: 58,206,043 S112P possibly damaging Het
Tacc2 T C 7: 130,692,963 L15P probably benign Het
Tas2r140 T A 6: 133,055,363 N144I probably damaging Het
Thpo T A 16: 20,725,957 R174S probably damaging Het
Tnik A T 3: 28,594,053 Q418L unknown Het
Tnr A T 1: 159,858,312 Q371L probably benign Het
Tulp2 G A 7: 45,520,974 R439Q probably damaging Het
Uchl4 G T 9: 64,235,324 W29L probably damaging Het
Vrk3 T A 7: 44,757,846 C80* probably null Het
Washc4 T C 10: 83,572,151 L540P probably damaging Het
Wscd1 T C 11: 71,784,335 F356S probably damaging Het
Wwc1 A T 11: 35,883,317 M372K probably benign Het
Zfhx2 A G 14: 55,074,734 F168L probably benign Het
Zfp28 A G 7: 6,390,400 D175G probably damaging Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
R8161:Rptn UTSW 3 93396693 small deletion probably benign
R8374:Rptn UTSW 3 93396295 nonsense probably null
R8671:Rptn UTSW 3 93398194 missense probably benign 0.18
R8934:Rptn UTSW 3 93395912 missense probably benign 0.00
R8938:Rptn UTSW 3 93395025 missense possibly damaging 0.93
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCCTGCCATCATAAGCTAG -3'
(R):5'- ACCTTTGGGCTGTTCATGAC -3'

Sequencing Primer
(F):5'- AAGTTCTATGGATCTAGAACCTCCTC -3'
(R):5'- GGGCTGTTCATGACTAGATTTATAAC -3'
Posted On2021-04-30