Incidental Mutation 'R7934:Osbpl11'
ID 648644
Institutional Source Beutler Lab
Gene Symbol Osbpl11
Ensembl Gene ENSMUSG00000022807
Gene Name oxysterol binding protein-like 11
Synonyms ORP-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 33185071-33243312 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33236382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 729 (W729R)
Ref Sequence ENSEMBL: ENSMUSP00000039632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039733] [ENSMUST00000232100] [ENSMUST00000232181]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039733
AA Change: W729R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039632
Gene: ENSMUSG00000022807
AA Change: W729R

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
PH 70 168 2.03e-14 SMART
low complexity region 257 268 N/A INTRINSIC
Pfam:Oxysterol_BP 383 749 1.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232100
AA Change: W723R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232181
AA Change: W729R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Abca8b G A 11: 109,975,039 T296I possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Eif2b3 C A 4: 117,066,478 Q297K probably benign Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Greb1l A T 18: 10,474,371 K229* probably null Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Kndc1 T A 7: 139,921,486 M897K probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Zfp971 A T 2: 178,033,380 K257N probably benign Het
Other mutations in Osbpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Osbpl11 APN 16 33241745 missense probably damaging 1.00
IGL01084:Osbpl11 APN 16 33226851 splice site probably benign
IGL03009:Osbpl11 APN 16 33241730 splice site probably benign
PIT4504001:Osbpl11 UTSW 16 33234494 missense probably benign 0.04
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0472:Osbpl11 UTSW 16 33234444 nonsense probably null
R0508:Osbpl11 UTSW 16 33196095 missense probably benign
R0609:Osbpl11 UTSW 16 33234444 nonsense probably null
R0715:Osbpl11 UTSW 16 33241730 splice site probably benign
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1275:Osbpl11 UTSW 16 33185850 missense probably benign 0.10
R1459:Osbpl11 UTSW 16 33236329 missense probably damaging 1.00
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1591:Osbpl11 UTSW 16 33209983 missense probably benign 0.00
R1752:Osbpl11 UTSW 16 33204835 missense probably damaging 1.00
R1883:Osbpl11 UTSW 16 33214353 missense probably benign
R1916:Osbpl11 UTSW 16 33185843 missense probably benign
R1916:Osbpl11 UTSW 16 33210095 missense possibly damaging 0.82
R4369:Osbpl11 UTSW 16 33224648 missense probably damaging 1.00
R4649:Osbpl11 UTSW 16 33196082 missense probably benign 0.12
R4873:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R4875:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R6074:Osbpl11 UTSW 16 33209965 missense probably benign 0.28
R6274:Osbpl11 UTSW 16 33227056 missense probably damaging 1.00
R7007:Osbpl11 UTSW 16 33226939 missense possibly damaging 0.81
R7399:Osbpl11 UTSW 16 33236279 missense probably benign
R7698:Osbpl11 UTSW 16 33234447 missense probably benign 0.04
R7814:Osbpl11 UTSW 16 33210061 nonsense probably null
R8870:Osbpl11 UTSW 16 33214480 missense probably benign 0.00
R8904:Osbpl11 UTSW 16 33227237 missense probably damaging 1.00
R9149:Osbpl11 UTSW 16 33227290 missense
R9328:Osbpl11 UTSW 16 33226875 missense probably damaging 1.00
R9486:Osbpl11 UTSW 16 33185913 missense possibly damaging 0.89
Z1177:Osbpl11 UTSW 16 33227084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGACTGCAGATCTGACTTAG -3'
(R):5'- ATTGAACCTGGCGCTCTC -3'

Sequencing Primer
(F):5'- TGGACTGCAGATCTGACTTAGAAATG -3'
(R):5'- ATCTGAACTGGGCATCATGC -3'
Posted On 2020-09-15