Incidental Mutation 'R7934:Abca8b'
ID 648634
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene Name ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms Abca8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109932190-109995845 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109975039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 296 (T296I)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
AlphaFold Q8K440
Predicted Effect possibly damaging
Transcript: ENSMUST00000020948
AA Change: T296I

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: T296I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106669
AA Change: T296I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: T296I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Eif2b3 C A 4: 117,066,478 Q297K probably benign Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Greb1l A T 18: 10,474,371 K229* probably null Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Kndc1 T A 7: 139,921,486 M897K probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Osbpl11 T A 16: 33,236,382 W729R probably damaging Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Zfp971 A T 2: 178,033,380 K257N probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 splice site probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R8074:Abca8b UTSW 11 109938494 missense probably benign
R8302:Abca8b UTSW 11 109962580 critical splice donor site probably null
R8341:Abca8b UTSW 11 109955050 missense probably damaging 1.00
R8486:Abca8b UTSW 11 109967111 missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109945771 missense probably damaging 1.00
R8924:Abca8b UTSW 11 109947177 missense probably benign 0.00
R9002:Abca8b UTSW 11 109952630 missense probably benign 0.02
R9032:Abca8b UTSW 11 109957247 missense probably benign 0.04
R9099:Abca8b UTSW 11 109980882 missense probably damaging 1.00
R9124:Abca8b UTSW 11 109937767 missense probably damaging 0.97
R9178:Abca8b UTSW 11 109950111 missense probably benign 0.00
R9188:Abca8b UTSW 11 109981735 nonsense probably null
R9277:Abca8b UTSW 11 109976521 missense probably damaging 0.99
R9340:Abca8b UTSW 11 109950113 missense probably benign 0.43
R9371:Abca8b UTSW 11 109967672 missense probably damaging 1.00
R9382:Abca8b UTSW 11 109979885 missense probably benign
R9450:Abca8b UTSW 11 109969104 missense probably damaging 0.98
R9462:Abca8b UTSW 11 109953607 missense
R9712:Abca8b UTSW 11 109942337 missense probably benign 0.30
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGGAGTTTTGTGTGCAAACAG -3'
(R):5'- TGCATCTCCTAAAACATGCAGTACC -3'

Sequencing Primer
(F):5'- GTTTTGTGTGCAAACAGAAGATAG -3'
(R):5'- CATGCAGTACCTGAAGAATGGC -3'
Posted On 2020-09-15