Incidental Mutation 'R8476:Sall3'
ID657278
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8476 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80972118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 865 (S865*)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably null
Transcript: ENSMUST00000057950
AA Change: S865*
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: S865*

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,261,901 I176F possibly damaging Het
Aen A G 7: 78,907,199 Y123C probably damaging Het
Ahnak2 C T 12: 112,782,991 probably benign Het
Anks1 T A 17: 28,054,318 D970E probably damaging Het
Atn1 C A 6: 124,746,453 probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Ccdc172 T A 19: 58,552,838 probably null Het
Ceacam11 T C 7: 17,973,693 I134T probably benign Het
Clec4e A G 6: 123,286,276 S73P probably benign Het
Dchs1 A G 7: 105,758,808 I1939T probably benign Het
Dclk1 A T 3: 55,533,679 E432V probably damaging Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Kdm3a T C 6: 71,611,709 K439E probably damaging Het
Klhdc7a A C 4: 139,965,740 I632S probably damaging Het
Krt72 A T 15: 101,778,266 M415K probably damaging Het
Lax1 T A 1: 133,683,588 H82L probably benign Het
Morc2b T A 17: 33,135,859 T980S possibly damaging Het
Mta2 T A 19: 8,950,988 N550K probably benign Het
Olfr213 T A 6: 116,540,546 I31N probably benign Het
Olfr566 A T 7: 102,856,945 F112L probably benign Het
Pask A G 1: 93,321,639 W680R probably benign Het
Pcdhb13 A T 18: 37,444,084 N505I probably damaging Het
Pik3cd A T 4: 149,651,820 M984K probably damaging Het
Ptprm T C 17: 66,944,322 Y520C probably damaging Het
Pum1 A G 4: 130,752,713 S547G possibly damaging Het
Rabep2 C T 7: 126,435,743 R64* probably null Het
Rfxank T C 8: 70,138,178 N13S probably benign Het
Scaper T A 9: 55,762,291 D854V probably damaging Het
Slit3 G A 11: 35,629,769 D578N possibly damaging Het
Smarcd1 G T 15: 99,702,424 G35W probably damaging Het
Trim24 C T 6: 37,945,643 Q462* probably null Het
Ube3a C T 7: 59,304,827 T837I probably damaging Het
Vps13a T C 19: 16,722,457 I740M possibly damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGCTCTCACCATTACTGTGAG -3'
(R):5'- CGACCTGCCCTTTGATGAAAAG -3'

Sequencing Primer
(F):5'- TCTCACCATTACTGTGAGCAGGG -3'
(R):5'- AGAGACCCTCAGCAGCTTTG -3'
Posted On2021-01-18